1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataly_w [17]
3 years ago
12

HELP PLEASE ASAP

Biology
1 answer:
Cloud [144]3 years ago
3 0
A, B, and C. Luster is the light and how light reflects off of it, right?
So, in that case, a non metallic mineral, (think coal) wouldn’t shine much. A metallic mineral would shine, because it’s metal. And something that’s shiny obviously shines.
Go with A B and C.
You might be interested in
Can someone help me with this question plss
neonofarm [45]

Answer:

unkown

Explanation:

6 0
2 years ago
Innate immunity________.
labwork [276]

Answer:

The answer is A.

Explanation:

Since only 1 of the options is wrong, i assume you are looking for that one.

Two types of immunity systems, innate immunity and adaptive immunity. Adaptive immunity is formed when it is exposed to a harmful substance, vaccines for example create adaptive immunity.

Innate immunity is present at birth which consists our skin protects us physically, chemical substances in our blood that protect us from bacteria and infections and also our blood cells such as T cells.

Since innate immunity forms one of the first lines of defense in our immune system and is the first to respond to a threat in a few hours down to as little as minutes, it is not slower than adaptive immunity in its response to infections and pathogens.

I hope this answer helps.

4 0
3 years ago
Check Your Understanding<br> Question: What is an adaptation?
AleksandrR [38]

Answer:

an adaptation can be defined as an inherited trait which confers an evolutionary advantage to the organism in a certain environment

Explanation:

An adaptation, also known as an evolutionary adaptation, can be defined as any physiological and/or morphological inherited trait related to the improved evolutionary fitness of one organism in a particular environment. An adaptation improves the chances of survival and reproduction in a certain environment, thereby organisms carrying the adaptation have more chances to produce descendants and pass their genes to the next generation. Some classical examples of evolutionary adaptations include the long necks of giraffes that help them to eat leaves at the top of trees, light bones of flying birds, etc.

8 0
3 years ago
Answer asap asap!<br><br><br> bio
astra-53 [7]
Either B and D I believe I may be wrong..
8 0
2 years ago
Pls help me woth this answer ty​
liubo4ka [24]
Is kinda blurry can u take a better picture
4 0
3 years ago
Read 2 more answers
Other questions:
  • In sigmund freud's theory, the _______ operates according to the pleasure principle. (1 point)
    14·1 answer
  • The rise of industrialization was accompanied by _____.
    10·2 answers
  • George damaged a cranial nerve. His quality of life has decreased because he is no longer able to smile, move his mouth when he
    11·1 answer
  • What is the function of haemoglobin​
    12·1 answer
  • How do we store chemical energy and then how is it released
    6·1 answer
  • FIRST ANSWER GETS BRAINLIEST:
    15·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The infections that people get while they are in hospitals are commonly resistant to multiple drugs. What is a reason for the in
    9·1 answer
  • which of the following explains why cells that contained mitochondria like organelle had an evolutionary advantage
    12·1 answer
  • Many hockey sticks are made of composite materials instead of wood. How would you classify each type of hockey stick?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!