1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena-s [515]
3 years ago
15

What causes a glacier to grow or recede

Biology
2 answers:
Goshia [24]3 years ago
3 0
Temperature causes these changes.
zalisa [80]3 years ago
3 0
Snowfall at their point of origin. As the overlying snow becomes heavier, the snow below becomes more dense and turns into ice. The weight of the ice causes the glacier to flow downhill from its point of origin, usually near the top of a mountain range.
You might be interested in
Which topics would be most important for you to understand if you wanted to be certified as a lifeguard? Check all that apply. d
Cerrena [4.2K]
The work of a lifeguard<span> is is to rescue and to ensure the safety of swimmers, surfers, and other water sports participants such as in a swimming pool, water park, or beach. To be a certified lifeguard, you must understand the following:

1. D</span><span>eveloping evacuation plans </span><span>
2. </span><span>Florida-friendly beaches 
3. S</span><span>aving people caught in rip currents
4. Identifying signs of oncoming tsunamis</span>
5 0
3 years ago
Read 2 more answers
Examining a dolphin _________ highlights its evolutionary history. Early in dolphin development, both fore and hind limb buds fo
Delvig [45]

Answer:

The suitable words for fill in the blanks will be -

  1. embryo
  2. flippers
  3. disappear
  4. off
  5. genetic

Explanation:

Examining a dolphin embryo highlights its evolutionary history. Early in dolphin development, both fore and hind limb buds form. While the forelimb buds continue to develop into flippers, the hind limb buds disappear. The genes that are normally active in the hind limb buds of four-limbed animals are turned off. A genetic change leading to the silencing of a trait during development may have been an important milestone in cetacean evolution.

4 0
3 years ago
Which two sentences contain examples of responsible lab safety behavior?
dlinn [17]

Answer:

Sentences 5 and 6.

Explanation:

¨Jared is also very quick in his work and disposes of dangerous chemicals immediately after completing an experiment by dumping them in the lab sink.¨ shows how he disposed of the chemicals properly to avoid spills and leaks.

¨Jared never eats or drinks in the lab so that he won’t accidently swallow the chemicals he works with.¨

not eating in the lab is another reponsible saftey behavior.

8 0
3 years ago
Which two macromolecules contain nitrogen?
aalyn [17]

Answer: Option A) Proteins and nucleic acids

Explanation:

Proteins are composed of several amino acids with positively charged amino groups in their side chain. These amino groups (NH2) have nitrogen atoms in them.

Nucleic acids, as well have nitrogen atoms in the nitrogenous bases present in their structure. E.g DNA and RNA has Adenine molecules with two nitrogen atoms in its structures

5 0
4 years ago
The gene frequency for a dominant allele is 0.68 and the recessive allele is 0.39. What percent of the population has a homozygo
Alinara [238K]

Answer:

15.21 %

Explanation:

If we recall the basic formula of Hardy-Weinberg's equilibrium ; we have the following below:

p + q = 1

p² + 2pq + q² = 1

where;

p = frequency of the dominant allele in the population

q = frequency of the recessive allele in the population

p² = percentage of homozygous dominant individuals

q² = percentage of homozygous recessive individuals

2pq = percentage of heterozygous individuals

Given that p= 0.68 and q = 0.39

the percentage of the homozygous recessive genotype (q² ) will be

(0.39)² = 0.1521

= 0.1521 × 100

= 15.21 %

∴ the percentage of the population that has a homozygous recessive genotype = 15.21 %

5 0
3 years ago
Other questions:
  • What cellular process produces most of the atp
    12·1 answer
  • The solution that surrounds the ameba is a
    6·1 answer
  • What’s the difference between habitat and niche
    9·1 answer
  • Organisms that have been modified to contain DNA from other species are known as: (Select all that apply.)
    11·1 answer
  • Is____the fluid component of blood.
    14·2 answers
  • Differentiate between the Lock and key model vs the induced theory model.
    5·1 answer
  • What do you think the primary_impacts (the first and most major effects) of the earthquake would
    7·1 answer
  • Why does the thermosphere increase in temperature as altitude increases?
    8·1 answer
  • F f(x) = 5x + 40, what is f(x) when x = –5?<br><br> –9<br> –8<br> 7<br> 15
    7·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!