1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marissa [1.9K]
3 years ago
6

Which sound wave, A or B, has higher intensity?

Biology
2 answers:
Aleks [24]3 years ago
3 0

B

The loops (idk what there called) are closer together. Hope this was helpful.

Brainiest please (:

nignag [31]3 years ago
3 0

Answer:

B

Explanation:

just got it correct

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Deep vein thrombosis
Orlov [11]

Answer:

what about it?

Explanation:

6 0
3 years ago
What is the name of the lymphatic vessels located in the small intestines?
Jet001 [13]
Lacfeals is the answer
4 0
3 years ago
Which of the following statements is FALSE regarding antibodies?
algol13
Hey friend!
Let's figure this out!


<span>There are three classes of antibodies- is FALSE statement regarding Antibodies. ***There are 5 classes of human antibodies: IgG, IgM, IgA, IgD, and IgE.


Hope this helped!</span>
5 0
3 years ago
1)A condition or event in the environment is called a _____.
lora16 [44]

Answer:

stimulus

Explanation:

6 0
3 years ago
Other questions:
  • As ____________ increases, the two-point threshold decreases. receptor number receptor density receptor sensitivity receptor sen
    8·1 answer
  • 20. How did HeLa cells make it possible to diagnose trisomies like Down syndrome?
    14·1 answer
  • Why do you think that concerns about the environment did not emerge in marine science until the late twentieth century?
    9·1 answer
  • Which of these is a provisioning service - a benefit that is obtained directly from the environment
    7·1 answer
  • You observe a species of bird that, upon hatching, has contact with its parents only while being fed. you also never hear the pa
    10·1 answer
  • Work id done on a ball when a soccer player kicks it. Is the player still doing work on the ball as it rolls across the ground?
    15·1 answer
  • which off the statement is true The most populous country in the world is: Japan China Russia the United States
    7·1 answer
  • Genetic variation occurs when chromosomes are shuffled in fertilization and what other process?. mitosis mutation meiosis geneti
    14·2 answers
  • Which of the following is a property of water? (4 points)
    10·1 answer
  • In 1831, Charles Darwin visited the Galapagos Islands While observing the giant land tortoises that lived on these islands, Darw
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!