1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allsm [11]
3 years ago
5

Help wanted, if you could further explain that would help a lot too.

Biology
1 answer:
solong [7]3 years ago
8 0

Answer:

D. Water molecules will move across the cell membrane at a faster rate with late regulation from the aquaporin.

You might be interested in
Help?! (There is two screenshots with 1 question on both)
Gelneren [198K]

with the prey there is always going to be something that is going to eat them it is called the food chain

7 0
3 years ago
The overgrowth of algae poses a major problem for coral reefs intensive fishing is one fact that contributes to algae overgrowth
Korvikt [17]
Hydfvhb BBC fhsuhvtg theyyyrg eyeyyrvr shuththtb
7 0
3 years ago
10 POINTSS!!! Which is a independent variable?
Effectus [21]
The independent variable should be the plants you used.
5 0
3 years ago
Read 2 more answers
Question down below thanks
lilavasa [31]

Explanation:

X is the answer

3 0
3 years ago
When a litter of puppies is born, the pups will exhibit certain physical characteristics that can be found in one or both of the
S_A_V [24]

Answer:

Inherited traits.

Explanation:

Inherited traits are ones passed down from parent to offspring!

8 0
3 years ago
Read 2 more answers
Other questions:
  • With the example of the GMO mosquito being introduced into a population of mosquitos
    15·1 answer
  • Describe the relationship between bird species richness and tree species richness
    6·2 answers
  • Where in the body can you find chemoreceptors?
    7·2 answers
  • What would happen if more forests are cut down?
    6·2 answers
  • What determines the properties of a mineral?
    12·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The endocrine system often uses a negative feedback process to what
    13·2 answers
  • Which of the following is the definition of animal husbandry?
    11·1 answer
  • Is a coconut a vegetable or fruit?
    10·1 answer
  • 3. Human skeletal remains were located along a hiking trail in northern Wisconsin. Law
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!