1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksandrR [38]
4 years ago
12

The classification of anthropoid primates such as chimpanzees, gorillas, orangutans,

Biology
1 answer:
OLga [1]4 years ago
3 0

Answer:

C) the group is paraphyletic.

Explanation:

In the classification of hominoids, the orangutan, gorilla, and chimpanzee are grouped together into the Pongidae family; while humans are placed in another family (Hominidae) because this classification recognizes to Pongidae as a paraphyletic group. The paraphyletic groups are the taxa that have a common ancestor and include some (instead of everyone) their descendants. In this case, the Pongidae family is composed of genera that descended from one ancestral species but does not include the complete list of the descendants of that species.

You might be interested in
PLEASEEE
DerKrebs [107]

Answer:

Secondary Succession

Explanation:

Secondary Succession is faster than primary succession because soil is already there, and the soil usually contains many nutrients.

Examples: Secondary succession occurs when the severity of disturbance is insufficient to remove all the existing vegetation and soil from a site. Many different kinds of disturbances, such as fire, flooding, windstorms, and human activities (e.g., logging of forests) can initiate secondary succession.

4 0
3 years ago
What are productsRead Changes on Earth and Changes in Life. Explain how changes in Earth’s systems affect the growth of life on
arlik [135]

Answer:

There are many changes that is ongoing on the earth. Some of the changes are short term changes and the others are long term changes.

These changes are due to the effect of human activities or due to natural processes.

The life of organism depends on these geological processes that keeps on going with time. The growth and development of the organism is hampered by these processes.

Change is the rule of nature and it keeps on changing with time. There has been 5 massive mass extinctions which has affected the life of plant and animal species.

Many of the species have been extincted due to this process.

6 0
4 years ago
What happens if one part of an ecosystem in damaged or destroyed?
Westkost [7]

hello there

the answer is

If all the decomposers in an ecosystem were destroyed then the ecosystem would all apart.

This is because they give the nutrientsback to the soil in order for new organisms to grow.

thank you

4 0
3 years ago
Read 2 more answers
During which stage of interphase does the cell grow to nearly its full size? (3 points)
svetoff [14.1K]
This occurs during protein synthesis. This is because the cell continues to protein synthesise, therefore adding to the amount of cells.

I hope this helps.
4 0
3 years ago
Read 2 more answers
How many alleles exist for a given gene?
mario62 [17]
In a diploid organism, one that has two copies of each chromosome, two alleles<span> make up the individual's genotype.</span>
6 0
4 years ago
Other questions:
  • Fossils found in a cave at krapina, croatia, show evidence of:
    6·1 answer
  • Why is ATP used as an active energy source over glucose?
    6·1 answer
  • What provides the best evidence for gradualism?
    9·1 answer
  • If one link in the chain of infection is missing, an infection can still spread. True or false
    6·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • In which generation gametophyte or sporophyte do the following belong
    9·1 answer
  • I need help with quiz
    8·1 answer
  • What is the image point of
    8·2 answers
  • There are 20 different types of amino acids, which can result in a wide variety of protein shapes. Which of the following is not
    10·1 answer
  • What is the plasma (cell) membrane? What is its main function?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!