1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andre [41]
3 years ago
10

What is the best topic to choose for a science fair project

Biology
1 answer:
saveliy_v [14]3 years ago
7 0
This isn't a topic. But a good tip is to choose something you find interest in. This way you can present your project in a good, happy manor and actually enjoy doing the project.
You might be interested in
Describe how proteins form (polypeptide)
Natalka [10]

Answer: Atoms were created after the Big Bang 13.7 billion years ago. As the hot, dense new universe cooled, conditions became suitable for quarks and electrons to form. Quarks came together to form protons and neutrons, and these particles combined into nuclei.

3 0
3 years ago
Read 2 more answers
The golgi complex packages cellular products that will be exported from the cell into which structures?.
Step2247 [10]

The  golgi complex package cellular products that will be exported from the cell into secretary vesicle structure.

<h3>What does the golgi apparatus export?</h3>

A golgi apparatus is a organelle that helps process and package protein and lipid molecules , especially proteins destined to be exported from the cell .

Secretory vesicle stores molecules and proteins from the endoplasmic reticulum and golgi apparatus until the cell is ready to release them .

to learn more about Golgi Apparatus click here

brainly.com/question/12723282

#SPJ4

3 0
2 years ago
Which statements about heat are true?
MariettaO [177]
The answer is b. hope this helps
5 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
What characteristic about the tundra biome is listed below does not contribute to a reduction of carbon dioxide on earth?
ivann1987 [24]
The correct answer of the given question above would be NUTRIENT-POOR SOIL. The characteristic about the Tundra biome listed below that does not contribute to a reduction of carbon dioxide on earth is the nutrient-poor soil. Other choices for this question include permafrost, carbon dioxide sink and <span>plants and their trapped carbon dioxide are frozen in the earth. </span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • What happens to proteins within the endoplasmic reticulum?
    9·1 answer
  • Which usually has within it a number of related classes? A. order B. family C. phylum D. species PLEASE HELP
    7·1 answer
  • A mushroom that you see above ground is actually a
    8·1 answer
  • Satellites are frequently used to make observations of the _____ on Earth
    11·1 answer
  • When ATP is broken down in cells, __________ and __________ are the products.
    12·1 answer
  • Chromosomes that carry the same corresponding genes at the same loci are said to be ---------.
    14·2 answers
  • 1.
    7·2 answers
  • Which statement best explains why the classification
    13·1 answer
  • 1. When did stromatolites appear on Earth?<br> Archean<br> Hadean<br> Mesozoic<br> Proterozoic
    9·1 answer
  • Why does exposure to high temperatures cause an enzyme to lose its biological properties?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!