1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Assoli18 [71]
3 years ago
10

The _____ reaction of photosynthesis produces oxygen and ATP.

Biology
2 answers:
klasskru [66]3 years ago
6 0
Is it light reaction but no that wont make sense

sammy [17]3 years ago
5 0
Is it light reaction but no that wont make sense

You might be interested in
What feature is common to prokaryotic and eukaryotic cells?
vekshin1
They both have cytoplasm, cell membranes, and DNA.
7 0
3 years ago
Read 2 more answers
he eastern coral snake and texas coral snake look almost identical and are often mistaken, but they are actually different speci
Degger [83]

Answer:

They will have sterile offspring.

Explanation:

7 0
2 years ago
Read 2 more answers
Does human intervention affect small-scale ecosystems differently than large-scale ecosystems?
sdas [7]

Answer: No

According to <u><em>BBC</em></u>, Human activities such as harvesting plants and hunting animals can unbalance the flows and cycles within those [SMALL SCALE ECOSYSTEMS ]ecosystems. Tree-felling may lead to soil erosion and a loss of habitat. Lack of shade and moisture in the soil can result in desertification.

According to <u><em>National Geographic</em></u>, Humans impact the physical environment in many ways: overpopulation, pollution, burning fossil fuels, and deforestation. Changes like these have triggered climate change, soil erosion, poor air quality, and undrinkable water.

GIVE BRAINLIEST :)

7 0
2 years ago
What type of protein stays only on the surface of the plasma membrane
nevsk [136]

Your answer is the peripheral proteins. Its on the inner or outer surface of the phospholipid bilayer, but not embedded in its hydrophobic core.

4 0
3 years ago
Read 2 more answers
Give three examples of what an ecosystem service is
Pavel [41]

Answer:

Examples of ecosystem services include products such as food and water, regulation of floods, soil erosion and disease outbreaks, and non-material benefits such as recreational and spiritual benefits in natural areas.

8 0
3 years ago
Other questions:
  • The _______ is responsible for cellular respiration in eukaryotic cells
    13·1 answer
  • Kingdom animalia includes a major phylum known as chordata, which includes the sub-phylum vertebrata. This includes lions like t
    11·2 answers
  • Which factors influence the mass movement of particles? Check all that apply. rain falling on a slope addition of vegetation to
    8·2 answers
  • Which layer confirms that this sample is soil rather than a mineral mixture?
    12·2 answers
  • One-celled organisms, such as bacteria, can reproduce very quickly using the process called _____.
    6·1 answer
  • What are the basics of biology?​
    10·1 answer
  • 1. Choose one of the bubbles. State whether you
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • A dependent variable is:
    7·2 answers
  • The connective tissue membrane that encloses a bone is the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!