1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksano4ka [1.4K]
3 years ago
13

Describe 3 characteristics of animals that make them different from plants.

Biology
1 answer:
astraxan [27]3 years ago
3 0

Answer:

They can move about freely.

They can reproduce.

They can respond to internal stimulus.

You might be interested in
UUUUU HAVEE E E E NNOOOOOOOO I DEAAAAAAAA I NEEEEDDDD HELLPPPPPP PLSSSSSSS!!!!
Verdich [7]

Answer:

How are we supposed to make a project for you....

Explanation:

7 0
3 years ago
Read 2 more answers
Which organs produces and secretes enzymes that are essential for proper digestion?
ollegr [7]

Answer:

An enzyme refers to a kind of protein found inside a cell. The enzymes result in the chemical reactions within the body. The function to accelerate the rate of chemical reaction in order to support life. The enzymes in the body assist in performing very essential functions. These comprise eradicating toxins, building muscle, and dissociating particles of food at the time of digestion.  

Enzymes are needed for performing the proper function of the digestive system. Digestive enzymes are primarily produced in the stomach, pancreas, and small intestine. However, even salivary glands generate digestive enzymes in order to dissociate the molecules of food at the time of chewing.  

There are three prime kinds of digestive enzymes, which are classified on the basis of the reactions they catalyze. These are protease, amylase, and lipase.  

3 0
3 years ago
Read 2 more answers
Name the renal process that occurs at the renal corpuscle.
schepotkina [342]
Answer: Filtration

Blood that is going to be filtered enters the first part of the nephron, the glomerulus, which is a tuft of capillary vessels. The glomerulus is inside a "sac" called a glomerular capsule.Together, the glomerulus and the glomerular capsule form the renal corpuscle, which is the filtering unit.
4 0
3 years ago
Which level of classification contains orders but is smaller than phylum?
jeyben [28]

Answer:

it is c not b

Explanation:

6 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • The process that removes metabolic waste products from an organism is known as
    7·2 answers
  • I need help with 5 vocabulary questions of Biology. I can only show one at a time.
    14·1 answer
  • Why does the nitrogen cycle never end ?
    13·2 answers
  • The cholera bacterium produces toxins that cause chloride ions to be secreted into the small
    14·1 answer
  • Which of the following processes can result in a new island population with a limited gene pool?A. artificial selectionB. gene p
    12·1 answer
  • What happens to an enzyme’s structure as it exceeds the typical human body temperature?
    8·1 answer
  • Which is NOT part of the Cell Theory? A) All cells come from existing cells. B) Microscopic organisms are not made of cells. C)
    7·2 answers
  • Which statement best describes a condition that would enable a hydrophobic solute to enter the cell?
    14·1 answer
  • PLEASE HELP ME :((((((
    9·1 answer
  • The ER has two distinct regions that differ in structure and function. Lipids are synthesized within the ________, and protein p
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!