1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
4 years ago
13

Each year, earthworms move deep into soil during fall and winter and return toward spring and summer. what is the likely stimuli

s for this behavioral response ​
Biology
1 answer:
o-na [289]4 years ago
6 0

Answer:

Each year, earthworms move deep into soil during fall and winter and return toward spring and summer. The likely stimulis for this behavioral response are relative humidity & temperature. Since the nematode breathes via the skin, the mucus coating may become dry & the organism would die if exposed to extreme cold & dryness.

Explanation:

You might be interested in
A pink-flowered Mirabilis plant (RW) is crossed with a
rodikova [14]
No. The answer is C, 1/4.
3 0
3 years ago
Lionfish have become an invasive species since their introduction into the Atlantic Ocean, where they have few natural predators
Rasek [7]
The last one sounds like a good idea
7 0
3 years ago
Read 2 more answers
Is the Cytoskeleton present in plant cells , animal cells or both
Radda [10]

Answer:

Animal cells

Explanation:

The cytoskeleton is not present in plant cells

6 0
2 years ago
Read 2 more answers
What is the role of estrogen ?
erastova [34]
The primary function of estrogens in women is development of female sexual characteristics during puberty. (Breasts, regulation of the menstrual cycle etc.)
In males estrogen helps in maturation of the sperm and maintenance of a healthy libido.
6 0
3 years ago
Read 2 more answers
Practices and activities for economic sustainability?
Varvara68 [4.7K]
- Recycling, organic material

- Wasting less

- Water filtration, conserving water

- the materials used to make products of clothing

Please vote my answer brainliest. thanks!
8 0
3 years ago
Other questions:
  • Which is the result of meiosis II? A. two diploid daughter cells B. four diploid daughter cells C. two haploid daughter cells D.
    7·2 answers
  • Connective tissue that specializes in the storage of fat
    8·1 answer
  • Carbohydrate: what elements do you expect to find in a carbohydrate?
    14·1 answer
  • What are like rivers of ice they move and flow through not very quickly at all
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Why can information only pass in one direction across synapse?? pls help !!
    15·1 answer
  • If a solid contain some particles that amount and 50°C and other particles amount mount at 110°C what must be true about the sol
    15·1 answer
  • Which of the following groups of organs all remove metabolic wastes from the human body?
    12·1 answer
  • Proteins are made up of one or more unbranched chains of
    13·1 answer
  • Blood sugar levels of the body need to be maintained, along with what other internal condition?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!