1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Doss [256]
3 years ago
9

Rosalind Franklin

Biology
1 answer:
kow [346]3 years ago
7 0

Answer:

I don't know spanish so I looked this up.

This translates to: Choose the state of time that describes each sentence.

The wind forms a cone and the roofs of the houses fly.

Explanation:

You might be interested in
The cell bodies of sensory neurons whose fibers enter the spinal cord are found in the __________.
Agata [3.3K]
Automatically region nervous system
7 0
4 years ago
The term catalyst comes from the greek catalysis, meaning dissolution. give reasons that this term is appropriate in describing
Masja [62]
Enzymes are meant to break down food in the mouth making it easier to consume and the food and gather the nutrients inside
8 0
3 years ago
Red imported fire ants are an ant species native to South America, but were introduced into the US in the 1950s.
Ann [662]

This is (b.) False, because it was actually introduced in the 1930's.

8 0
2 years ago
Which of the following correctly identified the five nitrogenous bases
Nataliya [291]
Thymine, Guamine, cytosine, and atanine make up the steps in dna (the nitrogenous bases) but the sided are a patter of phosphate then sugar.
- hope this is what you were wanting
7 0
4 years ago
The nervous system and the muscle system respond to stimuli to produce motion. The movements of
Tatiana [17]

The nervous system and the muscle system respond to stimuli to produce motion. The skeletal movements of muscles are mostly voluntary.

Involuntary movements occur in these muscles when the nerve impulse passes from a sensory neuron to a motor neuron via an interneuron in the spinal cord.

<h3>What are Skeletal muscles?</h3>

Skeletal muscles may be defined as the muscles that fasten to your bones and authorize you to achieve a broad range of activities and operations.

Skeletal muscles control the direct movement of a person's will and are hence referred to as voluntary movement.

While the spinal cord is associated with both movements directly or indirectly. It is a prolonged, delicate tubelike network liable for holding incoming and outgoing messages through the brain to the rest body.

Therefore, it is well described above.

To learn more about Skeletal muscles, refer to the link:

brainly.com/question/1283837

#SPJ1

5 0
2 years ago
Other questions:
  • Why do you suppose there is that 42-mile difference?
    10·2 answers
  • You might say the first stage of photosynthesis powers the "energy engine" of the living world.
    6·1 answer
  • Glen is attempting to use operant conditioning to train his dog, Thor, to fetch a ball upon command. To test Thor’s understandin
    14·2 answers
  • Scientists have recently discovered a community of bacteria and clams living under an ice shelf in Antarctica. These organisms l
    12·1 answer
  • How long does it take for a new species to arise? Have we ever witnessed a new species arising - like in any laboratories or oth
    10·1 answer
  • What is the ozonosphere
    5·2 answers
  • Think about water and how it rolls up on the beach. Think of all its qualities. Is It allve according to the characteristics of
    10·1 answer
  • Describe how amoebas obtain food?
    6·1 answer
  • What would happen if your hypothalamus didn't work properly
    14·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!