1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
3 years ago
12

Explain why fat loss during minimum food intake (fasting, starvation or extreme dieting) may be less than when at least some foo

d is supplied.
Biology
1 answer:
algol133 years ago
8 0
It is a common misunderstanding that if you starve yourself, the body will reduce the fat in your body. The truth is, the body slows down during starvation. If the body evaluates that you are starving yourself, it will hold on to the fat for energy. In contrary, the body will want less of your muscle tissues since those that are the ones which burn a lot of calories. In the long run, our metabolism aids in burning first the muscle tissues and little of your body fat.
You might be interested in
Proteins made on ribosomes may be further modified within which organelle?
madreJ [45]
D. golgi complex because it receives proteins and lipids from the ER , and packages and diatribes theses substances throughout the cell.
8 0
3 years ago
29.
forsale [732]

Answer:

The diagram represents the process of enlarging a rectangle using a scale factor of 3. The width of the original rectangle must be:

9 in.

11 in.

12 in.

17 in.

Explanation:

7 0
2 years ago
Generalizations, explanations of natural phenomena, and additional hypotheses most often come about as a result of
natali 33 [55]

The explanations of natural phenomena, and additional hypothesis most often come about as a result of a scientific theory.

Explanation:

Scientific theory is a general explanation of natural phenomena developed through extensive and reproducible observations, more general and reliable than a hypothesis.

Then Every scientific theory starts as a hypothesis. A scientific hypothesis is a solution for an unexplained occurrence that does not fit into a currently accepted scientific theory. It must be based on careful rational examination of the facts.

7 0
3 years ago
In the formula, E K = 1/2 • m • v 2 if mass (m) was doubled, how much would kinetic energy
Viktor [21]

Answer:

mass doubled makes KE twice as large

velocity doubled makes KE 4 times as large

Explanation:

Try it with an example

m = 4

v = 8

KE = 1/2 m * v^2

KE = 1/2*4 * 8^2

KE = 1/2 * 4 * 64

KE = 128

Now double the mass

m  = 8

v = 8

KE = 1/2 8 * 8^2

KE = 1/2 8 * 64

KE = 4 * 64

KE = 256 double what it started out as.

Now do it again.

m = 4     That was the original mass

v = 16

KE = 1/2 4 * 16^2

KE = 2 * 256

KE = 512

When the velocity is doubled the KE becomes 4 times as big.

4*128 = 512

4 0
3 years ago
What makes rain and how does it fall to the ground?
____ [38]
Persipitation and geographic layout
8 0
3 years ago
Read 2 more answers
Other questions:
  • What is the best way to help you ensure continued success in both fitness and life?
    13·2 answers
  • Will Lithium and chlorine form and ionic bond? Explain.
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Two different populations of birds live in the same area and eat the same type of food
    12·1 answer
  • If the process of meiosis shown here proceeds normally, how many chromosomes will cells a, b, c, and d have? a 2 each b 6 each c
    13·1 answer
  • Which organism has a nerve net that allows it to respond to a stimulus in a coordinated way?
    14·1 answer
  • The texture in the opening phrase of this work is:
    15·1 answer
  • Based on the weathering patterns, guess the rock type shown in each photo.
    10·1 answer
  • Molecule 1 has the following sequences of bases: AGCTTA. Which set of base in molecule 2 will bond to this sequence in complemen
    6·2 answers
  • (GIVING BRAINLIEST!!)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!