1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vika [28.1K]
2 years ago
14

Phosphorus is required to synthesize the deoxyribonucleoside triphosphates used in DNA replication. A geneticist grows some E. c

oli in a medium containing nonradioactive phosphorus for many generations. A sample of the bacteria is then transferred to a medium that contains a radioactive isotope of phosphorus ( 3232P). Samples of the bacteria are removed immediately after the transfer and after one and two rounds of replication. Assume that newly synthesized DNA contains 3232P and the original DNA contains nonradioactive phosphorus. What will be the distribution of radioactivity in the DNA of the bacteria in each sample? Will radioactivity be detected in neither, one, or both strands of the DNA?Think about what this looks like after 1 round of replication. Two rounds? Also, what would this look like if the conserved model or dispersive model of replication were correct instead?
Biology
1 answer:
Harlamova29_29 [7]2 years ago
4 0

Answer:

<h2> After one round: one strand of DNA  will contain radioactive 3232P, while the other strand  will not contain any radioactive phosphate. </h2><h2> After two rounds:  here 50%  of DNA will have 3232P in both strands, while 50% will contain 3232P in one strand and nonradioactive in the other strand. </h2>

 

Explanation:

1. In the initial sample which is immediately removed after addition of radioactive isotope of phosphorus ( 3232P), hence there is  no incorporation of 3232P into the DNA because replication in the medium containing 3232P has not yet occurred.  

2. After one round of replication in  radioactive isotope of phosphorus ( 3232P) containing  medium, here  only one newly synthesized strand of DNA molecule will contain 3232P, while the other strand  will not contain any  radioactive isotope of phosphorus ( 3232P),  because DNA replication occurs in semi-conservative way.

3. After two rounds of replication in medium which contains radioactive isotope of phosphorus ( 3232P), here 50% of the DNA molecules will have  radioactive isotope 3232P in both strands, while the rest 50% will contain 3232P in only one strand and nonradioactive phosphorous in the other strand.

You might be interested in
Which of the following is a true statement? a. Mammals were the prominent species just before the extinction of dinosaurs. b. Ma
Angelina_Jolie [31]

Answer:

The correct answer is B.

Explanation:

Option A is wrong. Mammals were not the prominent species before the extinction of dinosaurs because the mammal species that lived during the dinosaurs' era were so small that they only weighed several grams and occupied small areas as their habitats.

Option C is wrong. As dinosaurs became extinct, reptiles and "birds" remained as their descendant which evolved to some of the species that we know today.

Option D is wrong. Pangea started to break up to form the geographic isolation for the diversion of many species around 175 million years ago.

So the correct answer is B. Massive extinction disrupts and changes the food chain in such a big way that it triggers a domino effect that leads to species adapting to their new environment and diversifying thus forming new species in the process.

I hope this answer helps.

5 0
3 years ago
_____ helps to destroy animals and plants when they die, preventing them from fossilizing.
valkas [14]

Answer:

Oxygen

Explanation:

5 0
3 years ago
Which is a phenomenon that can result from directional selection? a. There is an increase in the number of different breeds of d
anzhelika [568]

Answer:

B) There is an increase in the number of giraffes with long necks in areas of Africa where low-growing trees have died

Explanation:

The directional selection is one of the ways of the natural selection in which the natural selection selects or favours the most extreme trait of the species and the extreme trait show higher fitness than the normal or average trait.

In the given question, the case of Giraffe necks shows directional selection as the normal length of the neck is not favoured by the environment but the extreme trait that is long neck is favoured by the environment and the selection shifted to that level.

Thus, Option-B is the correct answer.

5 0
2 years ago
Read 2 more answers
Do you think graphite would most likely display cleavage or fracture? Explain
Brums [2.3K]

In graphite, carbon atoms are arranged in layers. Graphite has cleavage because the weak bonds between the layers break easily. Add a description wheel for fracture in your notebook.

7 0
2 years ago
What is a binomial nomenclature?
Iteru [2.4K]

The answer would be D


3 0
2 years ago
Other questions:
  • ANSWER I WILL MAKE YOU THE BRAINLIEST Organisms can reproduce sexually or asexually. There are important differences between the
    8·2 answers
  • A. what is the name of the pigment that captures light directly in photosynthesis
    9·1 answer
  • Statistically, which adolescent is most apt to experience menarche first?
    12·1 answer
  • which of the following are the building blocks of protein a. monosaccharides b.amino acids c.RNA d. starches
    13·1 answer
  • Use photosynthesis in a sentence
    14·1 answer
  • The pedigree below shows two generations of individuals within a family. The pedigree shows
    6·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What effect does the sun have on the skin to cause cancer
    11·2 answers
  • A male bison charging another male bison is an illustration of which behavior?.
    13·1 answer
  • To understand the chemical basis of inheritance, we must understand the molecular structure of dna. this is an example of the ap
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!