1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnom [1K]
3 years ago
6

Katy is on a path, moving towards a bridge. The given table represents a function that describes Katy’s distance from the bridge

, in meters, after x minutes of walking.
A. Katy was 250 meters from the bridge, and it took her 5 minutes to reach the bridge.
B. Katy was 250 meters from the bridge, and it took her 6 minutes to reach the bridge.
C. Katy was 300 meters from the bridge, and it took her 5 minutes to reach the bridge.
D. Katy was 300 meters from the bridge, and it took her 6 minutes to reach the bridge.

Mathematics
1 answer:
Sophie [7]3 years ago
3 0

Answer:

D : Katy was 300 meters from the bridge, and it took her 6 minutes to reach the bridge.

Step-by-step explanation:

Recall that x represents the time walked

When you see the first entry on the table as: x=0, that means Katy is about to start her walk, and the value to the right which represents her distance from the bridge is 300 meters. So as her walk started she was 300 meters from the bridge.

Now look at the last entry pair at the bottom of the table: the value in the "x" column (that represents the number of minutes she walked) reads: 6, and the value to the right (next column) reads 0 (0 meters from the bridge)

This is telling us that Katy was at the bridge after 6 minutes of walk. So answer D is the correct answer representing the given table of time and distance values.

You might be interested in
VERY EASY, WILL GIVE 50 POINTS FOR CORRECT ANSWER ASAP AND WILL GIVE BRAINLIEST.
Arada [10]
The answer is d. You are welcome
8 0
3 years ago
If FC IS RS 4430 and the BEP in unitsis 89, then contribution margin is ?
Umnica [9.8K]

Answer: RS 49.8

Step-by-step explanation:

Given the following :

Fixed cost = RS 4430

Break even point = 89 units

Recall:

Break even point in units = Fixed cost ÷ contribution margin

Therefore,

Contribution margin equals;

(Fixed cost ÷ break even point in units)

= 4430 / 89

= 49.775280

= RS 49.8

5 0
3 years ago
What is the opposite integer of –(–7)?
klio [65]
-7

-(-7) is 7 because two negative signs result in a positive. The opposite integer of 7 is -7
7 0
3 years ago
Thx u if u get the answer
trapecia [35]
So the man's age is divisible by 3, 5, and 7 but not by 2, 4, 6, or 8.

3 * 5 * 7 = 105
105 is not divisible by 2, 4, 6, or 8.
Not sure if any lower ages are there, but since the man is 105 years old, you would receive $105.
5 0
3 years ago
Read 2 more answers
A garden has 8 white roses and 11 yellow roses
Kisachek [45]
8+11=19. So there’s 19 roses in total
4 0
3 years ago
Read 2 more answers
Other questions:
  • Tom and his brother caught 100 fish on the weeklog fishing trip. the total weight of the fish was 235 pounds.
    14·1 answer
  • Can somebody please help me with this?
    10·1 answer
  • What expression is equivalent to 2(3a+2b-7)
    9·1 answer
  • HELP ME PLEASE!!!!!!!!!!!!!!!!!!!!<br><br>IM TIMED!!!
    12·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Given points B(−12,2), T(−8,10), A(−7,12), F(−6,10), and G(−2,2), which of the following proves that △BAG~△TAF?
    5·1 answer
  • I was thinking B am I correct?
    9·2 answers
  • The surface area of a figure is 62 cm^2. If the dimensions are multiplied by 4, what will be the surface area of the new figure?
    12·1 answer
  • You are performing a construction to copy a line segment so that it is
    8·1 answer
  • The 10 members of a hiking club will walk 9 miles. Each person will carry the food pack for an equal distance. How far will each
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!