1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Xelga [282]
3 years ago
6

You are wading in a river and watching the water waves washing over your feet if one of the waves washes over your feet every tw

o seconds what is the number of waves per second
Biology
1 answer:
Archy [21]3 years ago
7 0
You would say that the waves wash over your feet .5 times a second

You might be interested in
Owls eat voles (a relative of mice); voles eat grass and seeds. Which food chain is correct
snow_lady [41]
Owls eat voles than voles eat grass because voles live in grassy lands
5 0
3 years ago
There is a risk that __________ can be transferred when using stem cells in medical treatments. What word completes the sentence
Rina8888 [55]

Answer:

Bone marrow transplantation

Explanation:

Stem cells are special cells generated in bone marrow. This can changed into different types of cells. They are  red blood cells It carries oxygen to the body cells .White blood cells Resisting agents from infections . Platelets it performs clotting of blood

Stem cell transplant involves in removing of damaged cells instead placed stem places from blood or bone marrow

5 0
3 years ago
What causes formation of the fertilization envelope?
Sonja [21]

Answer:

Sperm-egg interaction

Explanation:

The formation of fertilization envelope is well-studied on the model system- sea urchin. It has been shown that, the fertilization envelope is formed after the initial sperm-egg interaction from the egg surface vitelline envelope and the paracrystalline protein fraction which is derived from cortical granules. Secretion from cortical granules, prevents polyspermy.

4 0
3 years ago
Aquaporins
oksano4ka [1.4K]

Answer:d. allow water to cross the plasma membrane via facilitated diffusion

Explanation:yeah

8 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Other questions:
  • Arrange the following events for the synthesis of RNA in the correct order: Nucleophilic attack of the 3′ OH group of the first
    12·1 answer
  • Where is most of a healthy person’s fat stored?
    10·1 answer
  • All the stars circled are the same size and give off the same amount of light. Which statement below do you agree with most? A.
    14·2 answers
  • Marine Biology question
    13·1 answer
  • The speckled appearance of a rock is called a rocks
    11·1 answer
  • Why might a cell make lots of rRNA but only one copy of DNA?​
    15·1 answer
  • PLEASE HELP ASAP
    15·2 answers
  • Which term is described as a shelf of undersea land reaching a depth of about 200 meters (656 feet) and extending out from the s
    11·2 answers
  • Construyamos 5 preguntas que nos sirvan para conocer más acerca de qué son las normas y las leyes y para qué nos sirven,
    5·1 answer
  • The following reaction is of photosynthesis:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!