1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lorasvet [3.4K]
3 years ago
12

What is the only force that acts on a falling body when it is in free fall

Biology
2 answers:
gladu [14]3 years ago
6 0
The only force is gravity
Dmitry_Shevchenko [17]3 years ago
3 0

Answer:

gravity

Explanation:

You might be interested in
What are some of the differences between crime scene investigations on TV and those that occur in real life? What are some of th
swat32

Answer:

People, not machines, perform fingerprinting. They do search for a particular amount of matches before taking into account a whole match.

Explanation:

7 0
2 years ago
Which statement best describes the relationship between activation energy and rate of reaction?
Alexus [3.1K]
The collar can be reused many times
4 0
3 years ago
Read 2 more answers
Country without any river is _____​
kari74 [83]

Answer:

Saudi Arabia is your answer ...

Explanation:

.

.

#hope it helps you..

(◕ᴗ◕)

5 0
3 years ago
Read 2 more answers
PLEASE HELP ME ASAP!!!!!!!!!!!! GIVING 15 POINTS
m_a_m_a [10]
Contemporary landscapes result from many causes, including variability in abiotic conditions, such as climate, topography, and soils; biotic interactions, such as competition, mutualism, herbivory, and predation, that can generate spatial pattern even when environmental conditions are homogenous; natural disturbances. I hope this helps :)
6 0
2 years ago
What is a limitation of using electron microscopes to view specimens? (2 points)
Grace [21]
The correct answer is <span>C. You cannot view live specimens because the necessary preparation kills cells. </span>

The answer is pretty self-explanatory. Unlike it, regular microscopes can view living creatures such as bacteria or similar.
4 0
2 years ago
Read 2 more answers
Other questions:
  • 2 Points
    8·1 answer
  • How is the process of stratigraphic correlation carried out?
    6·1 answer
  • The goal of a statement of purpose is:<br>​
    12·1 answer
  • Which of the following statements best describes the biosphere?
    12·1 answer
  • Which statement best describes a typical difference that could be found between the "Analysis" and "Conclusion" sections of a
    14·2 answers
  • The lac operon is expressed when ________.
    14·2 answers
  • What is the primary function of carbohydrates attached to the exterior of cell membranes?
    15·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What is the first step of the scientific method?
    8·2 answers
  • Los Parques Nacionales Naturales de Colombia se caracterizan porque:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!