Answer:
3f3 a job 4th in the world and the 44 year old has 444t46565y43 and the y5r 5 is 46th 75 to be 5th in 355756th to
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
Biology is the science that studies life, but what exactly is life? This may sound like a silly question with an obvious response, but it is not always easy to define life. For example, a branch of biology called virology studies viruses, which exhibit some of the characteristics of living entities but lack others. It turns out that although viruses can attack living organisms, cause diseases, and even reproduce, they do not meet the criteria that biologists use to define life. Consequently, virologists are not biologists, strictly speaking. Similarly, some biologists study the early molecular evolution that gave rise to life; since the events that preceded life are not biological events, these scientists are also excluded from biology in the strict sense of the term.
Explanation:
it's the structure of the nucleotides
the basic building unit of nucleic acid