1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IRISSAK [1]
3 years ago
9

Which differentiates the key chemical properties of nucleic acids, DNA and RNA?

Biology
2 answers:
Sergeeva-Olga [200]3 years ago
5 0
<span>Hydrocarbon structure</span>
katrin2010 [14]3 years ago
3 0
It is hydrocarbon structure
You might be interested in
What is a embryonic stem cell?
omeli [17]
An embryonic stem cell is the first cell in the embryo, this is what creates a human and helps more cells to form. 
8 0
3 years ago
HELP FAST! PHYSICAL SCIENCE salt is added to a flask of water. the flask is sealed and shaken for several minutes.After being sh
densk [106]

Answer:the following can be done to allow more NaCl to dissolve;

1.) heating the mixture.

2.) Addition of extra water to the solution.

Explanation:

When sodium chloride is dissolved in water, the polar water molecules are able to work their way in between the individual ions in the lattice. The water molecules surround the negative chloride ions and positive sodium ions and pull them away into the solution. This process is called dissociation. Now when the solution is heated, the rate of the dissociation between the two molecules increases leading to more dissolution of NaCl. Also in the absence of heating, more Water molecules can be added to the solution to decrease it's saturation thereby favouring the dissolution of more NaCl.

6 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Click an item in the list or group of pictures at the bottom of the problem and, holding the button down, drag it into the corre
ludmilkaskok [199]

Answer:

What

Explanation:

Please explain this better, I understand it but im not sure how anyone would do it

8 0
3 years ago
Read 2 more answers
Can you guys please help me on this
Semenov [28]
They need to divide so they replace old or damaged cells
3 0
3 years ago
Other questions:
  • What does it mean when the mother did not drink alcohol before getting pregnant, but then started to drink while pregnant?
    6·1 answer
  • Streptococcus causes more illness than any other bacteria.
    15·1 answer
  • What is a gamete ????
    13·1 answer
  • Which statement about ionic bonds is correct? A. Ionic bonds form when similarly charged ions are attracted to each other B. Ion
    15·2 answers
  • Please do this. Write a paragraph to describe the flow of energy from the Sun to the Earth (and atmosphere) and then back into s
    9·2 answers
  • What three processes lead to variation among offspring that have the same two parents?
    10·1 answer
  • Help me in biology ...
    8·1 answer
  • Explain how the Naked DNA exploits vector's DNA ability to make a vaccine.
    14·1 answer
  • Please help asap will mark brainliest!
    8·2 answers
  • The _________ is a temporary organ that is the site of exchange of oxygen, nutrients, and wastes between the mother and fetus, a
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!