1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zlopas [31]
3 years ago
10

Does your skeleton show when electrocuted

Biology
2 answers:
Svet_ta [14]3 years ago
7 0
It does not show when you're electrocuted
kkurt [141]3 years ago
5 0
No, that's just in comics and cartoons. xD If only. :P
You might be interested in
1. Explain why neither cyclins not kinases alone can cause a cell to progress along in the cell cycle.
Degger [83]
1. Explain why neither cyclins nor kinases alone can cause a cell to progress through the cell cycle.

As cyclin accumulates, it activates their kinases that turn on the pathway to mitotic spindle formation, and so on.

2. How do controls of the cell cycle protect multi-cellular organisms from accumulating large numbers of damaged or defective cells?

The checkpoint control is responsible for multi-cellular organisms for not accumulating large numbers of damaged or defective cells. Checkpoint controls consist of proteins that detect mistakes and damage and quickly halt the cell cycle until repairs are made. When this occurs, the cell is said to be in cell-cycle <span>arrest.

</span>3. What is the difference between a cancerous tumor and metastasis?
Cancer is cause by mutations in the genes that encode these proteins can lead to uncontrolled growth. Cancer is when there is uncontrolled cell growth and reproduction. Metastasis is caused by tumors when they grow and interfere with the surrounding tissue or cells and break off and spread around the body. Cancerous tumors cause metastasis, and tumors are caused by mutations in genes that lead to uncontrolled growth.
4. What are the functions of tumor-suppressor genes and protoncogenes in noncancerous cells?
The genes that encode the checkpoint proteins are called tumor suppressors because they suppress the development of cells into tumors. If mutations inactivate these genes, the cell-cycle break is removed with or without a signal from the outside. Proto-oncogene’s are involved in promoting cell division, mutations can cause them to become oncogenes, or cancer genes which stimulate cells to leave G0 and divide whether or not it is a signal.
6 0
3 years ago
Are there any information about fish muscle spindle?
il63 [147K]
What do you mean exactly
5 0
3 years ago
An etiologist is investigating a new disease and observes what appear to be bacteria inside tissue cells in clinical samples fro
Arturiano [62]

Answer:

Explained

Explanation:

The first thing that the etiologist can do is try and culture bacteria from the tissue samples in the lab. And then study about the bacterium's properties and characterstics that are leading to causing diseases in the humans.

5 0
3 years ago
What's the theme of this story
shutvik [7]
You don't have any story posted?
8 0
3 years ago
Read 2 more answers
Water crosses the plasma membrane through special channels known as _____.
Vinil7 [7]

Answer:

<em>aquaporins.</em>

Explanation:

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Specialized lymphatic capillaries called lacteals are _________.a. more numerous than blood capillaries. b. necessary for the tr
    6·1 answer
  • Clay particles are able to attract charged or polar organic molecules. Researchers have demonstrated that the concentration of o
    14·1 answer
  • Which ocean rim is called the "ring of fire" because of the several volcanoes and other tectonic activities present there?
    6·1 answer
  • The nurse caring for a client with tuberculosis anticipates administering which vitamin with isoniazid (inh) to prevent inh-asso
    15·1 answer
  • What is the polarity of water molecule
    6·1 answer
  • plant cells are much less flexible than animal cells. which cellular structure in plant cells is most responsible for this chara
    11·1 answer
  • All of the weather on Earth occurs in the thermosphere. <br> a. True<br> b. False
    14·2 answers
  • In gel electrophoresis, what is the agarose used for?<br> I NEED HELP I HAVE 4 mins left on my exam
    12·2 answers
  • Medicine is an example of pure science.<br> True<br> False
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!