1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allisa [31]
3 years ago
14

Which step is the same in both forms of fermentation, as well as in cellular respiration?

Biology
1 answer:
vitfil [10]3 years ago
4 0
That would be glycolysis which is part of both fermentation and cellular respiration :)
You might be interested in
17. Explain how carbon reservoirs can<br> be accessed without the influence<br> of humans.
PilotLPTM [1.2K]

Answer:Without human interference, the carbon in fossil fuels would leak slowly into the atmosphere through volcanic activity over millions of years in the slow carbon cycle. ... About half of these emissions are removed by the fast carbon cycle each year, the rest remain in the atmosphere.

Explanation:Hope this helps you!

8 0
3 years ago
Directions: Select ALL the correct answers,
Alexxx [7]

Answer: Option B is incorrect rest all the statements are correct.

Explanation:

A single trait can be controlled by multiple genes: A single trait can need multiple gene to be controlled. There are many traits in the body which can be controlled by the multiple genes in the body.

A single trait can alter multiple genes: The activity of a single gene can alter the activity of the multiple genes of the body. The faulty protein produced by the gene can also effect the other genes of the body.

A single gene can influence multiple traits: A single gene in the body can affect multiple characters of the body.  A single gene can be responsible or eye color, hair color, skin color et cetera.

6 0
3 years ago
Read 2 more answers
How do paleontologist use known evidence to make their observations? What are 2 of their observations
Ivahew [28]

Answer:

Explanation:

Paleontologists are scientists that use fossil records to study the history of life on earth. They use known evidence/fossils such as bones, prints (on land or sea), dead remains to determine evidence and history of past life on earth.

Some of there observations include the use of comparative anatomy to determine possible evolution. They also use carbon dating to determine approximately how long a fossil/bone has been in existence.

4 0
3 years ago
Paul's father and paternal grandfather both contracted but survived prostate cancer with treatment. Which answer best explains w
Ray Of Light [21]
Paul shud remove the prostat as soon as posible!!1!
Tem hope paul oki!

I hop i help u!

3 0
3 years ago
Read 2 more answers
A scientist discovered that Earth’s outer layer is made of plates. These plates can move. The movement of these plates explains
tankabanditka [31]

It explained the shift in in the earth from the plate tectonics and how when the volcano erupts it causes lava to come out

6 0
3 years ago
Other questions:
  • HELP I NIEED THE ANSWER ASAP!!!
    5·1 answer
  • Some bacteria live in the roots of plants like soybeans and peas.
    14·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What does the chemiosmotic process in chloroplasts involve?
    14·1 answer
  • Which form of poetry is a poet likely to use to narrate a fairy tale set to music?
    9·1 answer
  • Which term refers to the organism eaten by a predator
    7·1 answer
  • Using technology to modify the genes of a plant making it resistant to disease is an example of which type of genetic engineerin
    13·1 answer
  • HUMERO - DELTOIDES - COSTILLAS – TIBIA – CODO – BICEPS – ADUCTOR – MUÑECA – CUBITO – PECTORAL – CADERA – GEMELOS– VERTEBRAS – CL
    13·1 answer
  • Explain why it makes sense that the levels of estrogen and progesterone are low in blood of a female during menstruation
    11·1 answer
  • all other factors (concentration, solute size, etc.) being equal, which type of solute does a cell tend to pull inside?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!