1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ulleksa [173]
3 years ago
12

How do I do this I don't understand

Mathematics
1 answer:
oksian1 [2.3K]3 years ago
4 0
It's a ball, so a sphere.
V=4/3πr^3(That's the sphere formula)
V=128.
128=4/3πr^3
3.13 is your approximate radius.
r= (3* 128/4π)
You might be interested in
A certain medicine is given in an amount proportional to a patient's body weight. Suppose a patient weighing 104 pounds requires
sergeinik [125]

Answer:

223

Step-by-step explanation:

i think : )

7 0
2 years ago
A triangular pyramid has a surface area of 336 in made up of equilateral triangles side length 12 in. what is the slant height?
jasenka [17]
Find the slant height.

5 0
4 years ago
Read 2 more answers
|x|= 4 how to put it in a number line?
Alik [6]

Answer:

point on 4 and -4

Step-by-step explanation:

IxI = 4can either be 4 or -4

8 0
3 years ago
Read 2 more answers
PLEASE HELP!!!!!!!!! LOOK AT PIC, THANKS!!!!!!
mario62 [17]

Answer:

F (x) = 1,6

Step-by-step explanation:

my answer is due to the reason that it is one of the three options and it should only in a way make sense that it is the right answer

3 0
3 years ago
GIVING BRAINLIEST <br><br> SOLVE USING FACTORING <br><br> (8x^2 - 4x^2-3x+1)-(1-5x^2+ x)
irina1246 [14]

Answer:

4r to the power of 2 - 3r +1

3 0
3 years ago
Other questions:
  • What is the answer to this problem
    10·2 answers
  • Sjsjjsnsnsjdjdjkdkdkdkdkddkdidkdkdkkdkxkxkxkxkkxmxnxmxmxkmxkxkxkkxkx
    6·2 answers
  • Kamal bought 77 packs of paper clips for a project. then he bought 88 more packs. there are 2525 paper clips in each pack. how m
    8·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • How can we use 1/2 inch edge lengths to find the volume of a prism that is 1/2 inch by 2 inch by 3 1/2 inches? I will mark brain
    14·1 answer
  • Supriya is decorating her bedroom. She plans to hang strings of twinkle lights all the way around her walls. She measures the wa
    12·1 answer
  • Help me please this is urgent
    7·1 answer
  • Coach James and Mrs. Burch each conduct a survey at Highland Middle School to determine the ages of students in the cafeteria du
    10·1 answer
  • Write the sentence as a proportion.
    11·1 answer
  • Hello,how do I calculate the the volume of this compound shape?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!