The correct answer that would best complete the given statement above would be the first option. <span>A hawk maintains a constant internal temperature in both the heat of the day and the cool of night this is called endothermy. By definition, endothermy means that it is the physiological generation and regulation of body temperature by means of metabolism. Hope this answer helps.</span>
Bladder cancer, because of a mutation or damaged genes in the DNA of the cells.
Answer 1) : Change in direction.
Explanation : When an airplane starts to turn from south to west at constant speed gets accelerated due to change in direction. The change in direction of the airplane causes the airplane to accelerate in the direction of west while it was moving in south. Here the acceleration is being affected because of the change in direction of the object moving with a constant speed.
Answer 2) Change in direction and increasing speed.
Explanation : When a biker was riding at the speed of 5 m/s north and then changed the direction to west at an increased speed of 7 m/s this was due to increased speed and change in the direction of the bike.
There was two factors which contributed to change the acceleration in this case. It was because of change in speed of the bike and also because of change in direction. This kept the bike in acceleration by increasing the speed while changing the direction.
Answer 3) Increasing speed.
Explanation : While the shopping cart was observed to speed up on the runaway while it goes down a hill gets accelerated due to change in its speed.
In this case, when the shopping cart is been released from the upside runaway; as it goes down it gains more speed due to the slope of the runaway. This is because the acceleration is increasing because there is increase in the speed of the shopping cart.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
