1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
larisa [96]
4 years ago
11

Action potential propagation in a skeletal muscle fiber ceases when acetylcholine is removed from the synaptic cleft. Which of t

he following mechanisms ensures a rapid and efficient removal of acetylcholine?a) Acetylcholine is degraded by acetylcholinesterase.b) Acetylcholine is transported back into the axon terminal by a reuptake mechanism.c) Acetylcholine is transported into the postsynaptic neuron by receptor-mediated endocytosis.d) Acetylcholine diffuses away from the cleft.
Biology
1 answer:
klasskru [66]4 years ago
6 0

Answer:

a) Acetylcholine is degraded by acetylcholinesterase.

Explanation:

After it binds for its receptor on the plasma membrane of the postsynaptic cell, acetylcholine must be removed in order to prevent repeated stimulation. Acetylcholinesterase is enzyme for the inactivation of acetylcholine, present at all cholinergic synapses. This enzyme hydrolyses acetylcholine and breaks it to the acetate and choline. Choline can be reused for the synthesis of the new acetylcholine molecule so it is taken back into the presynaptic cell.

You might be interested in
Composting is the process of converting organic materials like plant material, food waste, and manure into humus. Humus is a soi
natka813 [3]
<span>B) It reduces the need for artificial fertilizers.

Composting makes a nutrient rich soil than can be used to help plants.
</span>
7 0
3 years ago
Read 2 more answers
Succulent plants store water. Given this characteristic, which biome would they be best suited to live in?
Ede4ka [16]
A desert biome, because since it can store water it wouldn't need a lot of water to survive, and deserts don't have very much rainfall.
4 0
3 years ago
Read 2 more answers
Which of the following pairs of structures are an example of homologous structures
Mekhanik [1.2K]
Well, a homologous structure is a bone or something else that is present in many different species that could point to a common ancestor. Since you do not have the examples in your question I will just give you some and hope that it helps you: 
The arm of a human, the wing<span> of a bird or a bat, the leg of a dog and the flipper of a dolphin or whale. 
</span>
I hope this helped! Let me know if it did not! 
I hope you have a fantastical day!!XD
5 0
3 years ago
Which change in DNA was a point mutation?
Margarita [4]

Answer: These external agents of genetic change are called mutagens. Exposure to mutagens often causes alterations in the molecular structure of nucleotides, ultimately causing substitutions, insertions, and deletions in the DNA sequence.

Explanation: Point mutations are a large category of mutations that describe a change in single nucleotide of DNA, such that that nucleotide is switched for another nucleotide, or that nucleotide is deleted, or a single nucleotide is inserted into the DNA that causes that DNA to be different from the normal or wild type gene

4 0
3 years ago
Sublimation is the opposite of deposition just as evaporation is the opposite of fusion transpiration freezing condensation
Lena [83]
<span>A condensation is a process where liquid changes into a gaseous form also known as water vapour. It occurs in the atmosphere when the temperature rises.
Water is produce when glucose and fructose undergo a condensation process. The water is removed by the combination of hydrogen and a hydroxyl together. Glucose and Fructose forms a substance called glycosidic linkage. And hydrogen and hydroxyl is separated from glucose and fructose. When Hydrogen and hydroxyl is combined, they create H2o or water.</span><span>
</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which is an advantage of flowering plants?
    6·2 answers
  • PLZ HELP ASAP!! (MAY BE GIVEN BRAINLIEST)
    10·1 answer
  • How do you producers different from all other organisms in the ecosystem
    8·1 answer
  • What do genes contain the code for?
    15·1 answer
  • Please answer I'm begging !!!
    6·1 answer
  • What animal can detect sound at a frequency of 67,000 Hz?
    5·2 answers
  • Which type of bond joins the COOH group of one molecule to the NH2 of another molecule? A. 1-4 Glycosidic bond B. Ester bond C.
    15·1 answer
  • Which two organelles are involved in endocytosis?
    14·1 answer
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • Which structure could a scientist look for in a plant that would identify it as a club moss rather than a liverwort?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!