1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zepler [3.9K]
3 years ago
7

The auditory neurons extending from the _____ reach out with their axons to the primary auditory cortex (a1) in the _____.

Biology
1 answer:
marta [7]3 years ago
4 0
The answer is temporal lobe. To simplify, the auditory neurons extending from the thalamus reach out with their axons to their primary auditory cortex in the temporal lobe. In addition, the temporal lobe of the cerebral hemisphere situated down on the side just forward of the occipital lobe. The temporal lobe comprises the auditory cortex which is accountable for hearing and it is also the site of the seizure commotion characteristic of temporal-lobe epilepsy.
You might be interested in
How do cells behave in a multicellular protist?
Sindrei [870]

Answer:

2.They exhibit cell specialization.

Explanation:

A protist is an eukaryotic organism that can either be unicellular or multicellular. In the multicellular protist i.e. many cells, different types of cells are needed to bring about the organism's life processes. The different types of cells perform a specific different function in the organism.

The way that an organism makes it cells specialized to perform different functions is called Cell Specialization or differentiation. All multicellular organism, including a multicellular protist, contain many cells that have been specialized to perform different functions. Hence, the many cells of a multicellular protist will exhibit specialization in order to perform varying functions in the organism.

7 0
3 years ago
Read 2 more answers
People who stop smoking between the ages of 45 and 54 reduce their risk of dying prematurely by approximately ________ percent.
joja [24]
They reduce it by 47 percent.
4 0
2 years ago
Which part of a plant begins the reproductive process to allow the plant to spread and grow new plants? (1 point)
zheka24 [161]

Answer:

Leaves

Explanation:

It gets sun and if water him he has these things like vens and its same for plant i think :)

5 0
2 years ago
Read 2 more answers
What characteristic makes the HeLa cells some of the most celebrated and widely used cells by scientists today? *
omeli [17]

Answer:

It's an immortal cell line derived from cervical cancer cells taken from Henrietta Lacks used in scientific cancer research

5 0
2 years ago
Replication in Living Cells
just olya [345]

Answer:

1. New chromosomes remain attached to cell membrane - Both

2. Proteins check for errors - Both

3. Starts at one place - Prokaryotes

4. Proceeds in two directions - Both

5. Copies of DNA condense into chromosomes that separate - Both

6. Starts at many places - Eukaryotes

Explanation:

The difference between prokaryotic and eukaryotic DNA replications is associated with the origins of replication, that is, the locations where replication starts. While in eukaryotic DNA, the origin of replication occurs in several places along the strands of DNA, replication in prokaryotic DNA has a unique origin of replication.

8 0
2 years ago
Read 2 more answers
Other questions:
  • Bottom trawling is a destructive fishing practice that destroys ocean habitats<br>T<br>F
    8·2 answers
  • A carbohydrate found in bread and pasta:
    15·2 answers
  • You notice your friends MP3 player is turned up so loud you can make out the words to each song though she is wearing earbuds. Y
    8·1 answer
  • What percent of North America is covered by forest
    12·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • C’est quoi le décompte chromosomique?
    13·1 answer
  • Dawn mistakenly took a multivitamin intended for men that contains 90 mg of vitamin C (or 100% of the vitamin C RDA for men). If
    14·1 answer
  • How does crossing over result in diversity within a species?
    13·1 answer
  • Certain substances pass from the blood in the glomerular capillaries into the ultrafiltrate under normal circumstances. Other su
    10·1 answer
  • Fill in: Name the organelle or organelles that perform each of the following functions. A. _____________________ convert sunligh
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!