1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viva [34]
3 years ago
15

Which of these statements is not true with regard to the process of evolution?

Biology
1 answer:
yan [13]3 years ago
4 0
The correct answer is C. It is a sudden change that causes species to become extinct.

This answer is not correct because evolution occurs over a long period of time, as evidenced by the theories that describe its timeline (including gradualism and punctuated equilibrium). Additionally, evolution does not always involve the extinction of a species, but it can.

Hope this helps!
You might be interested in
As a galaxy gets farther away from Earth, what happens?
Gemiola [76]
After the Big Bang happened, the universe is constantly expanding. The Universe has expanded for around 13.7 billion years. The further a galaxy is, the faster it would move away from Earth. This principle is called the conservation of momentum.
5 0
3 years ago
Read 2 more answers
What is the eyeball enclosed in?​
Debora [2.8K]

Answer:

sclera

The outer layer of the eyeball is a tough, white, opaque membrane called the sclera (the white of the eye). The slight bulge in the sclera at the front of the eye is a clear, thin, dome-shaped tissue called the cornea.

Explanation:

5 0
2 years ago
Read 2 more answers
Why is my male reproductive organ so big?
Bumek [7]
Is your testicles swollen ? You should go see a doctor. Especially if there’s pain.
7 0
3 years ago
Read 2 more answers
How can dna sequencing be used to identify other classes of pathogens, such as viruses?
professor190 [17]

DNA sequencing technique runs through database so it can compares all the sequenced information and finds similarities.

6 0
3 years ago
Read 2 more answers
The diagram below illustrates substances crossing the selectively permeable membrane of different cells. Each example, A-F, show
Nonamiya [84]

Answer:

A

Explanation:

the selectively permeable membrane should be plasma membrane.

and it states it follow concentration gradient

so i think it is <u>A</u>

osmosis is for water

I hope i helped you.

6 0
3 years ago
Other questions:
  • The first organisms on Earth were able to transform the carbon dioxide in the air into what essential element needed for modern
    6·2 answers
  • Help with question 3
    13·1 answer
  • Some traits do not obey Mendel's law. For example, people with red hair tend to also have pale skin. Why might this be the case?
    9·1 answer
  • (WILL MARK BRAINLIEST AND THANK YOU!) **EXTRA POINTS**
    13·2 answers
  • From a large-scale screen of many plants of Collinsia grandiflora, a plant with three cotyledons was discovered (normally, there
    13·1 answer
  • What is the name for the type of white blood cell that produces antibodies that help the body fight infection?
    10·2 answers
  • The air component in soil provides plants with the _ needed for photosynthesis
    5·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Describe the function of Occipital lobe.
    7·1 answer
  • After a devastating forest fire, the surrounding area contained no life. After some time, small plants began to grow along the r
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!