1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AveGali [126]
3 years ago
15

It is important to protect air quality because of what

Biology
1 answer:
Ber [7]3 years ago
3 0
It is an indicator of poor air quality from air pollution. This pollution is most often ozone or particulates. Typically it indicates that the air is unhealthy for children, the elderly, and sensitive groups.
You might be interested in
Complete the sentences to correctly describe steps in fatty acid synthesis. move the terms to the appropriate blanks. some terms
saw5 [17]

The synthesis of fatty acids starts with a preparatory step in which acetyl-CoA is mediated from mitochondria to the cytosol. However, it cannot pass through the membrane, so it is transported as citrate, which is cleaved to acetyl CoA and oxaloacetate.

In the cytosol, acetyl CoA is transformed to malonyl CoA, that is, a three carbon compound. Fatty acid synthesis starts with the conduction of acetyl group from acetyl CoA to fatty acid synthase.

Two carbon groups, supplied to malonyl CoA, are supplemented to the developing acyl chain in a series of steps involving condensation, reduction, and dehydration reactions. Elongation of the fatty acid chain ceases at 16 carbon atoms, after seven cycles, as the free free fatty acid is discharged.

8 0
3 years ago
List the 4️⃣stages of mitosis. *
jekas [21]

Answer:

Prophase

Metaphase

Anaphase

Telophase

Explanation:

Use the slugon PMAT

3 0
3 years ago
Current treatment for wilms' tumor includes __________.
liraira [26]
Current treatment for Wilms' tumor includes Surgery and radiation. 
Wilms tumor is a type of cancer that starts in the kidneys.  It is the most common type of cancer in children. It is a rare kidney cancer that primarily affects children. Surgery treatment to remove the tumor is the first treatment if it can be done, followed by radiation therapy. The entire abdomen will be treated if there is still some cancer left after surgery. If the cancer has spread to the lungs, low doses of radiation might also be given to that area.
8 0
3 years ago
What are the different blood types
Mashutka [201]
There are four blood types they are A, B, AB, and O
8 0
3 years ago
Project: analyzing cellular Respiration!!!!<br>Does anyone know how to do this project?​
Basile [38]

Answer:

In order to complete this project you would need to discuss the process on what happens in a healthy cell. Like what goes in the cell, what does the cell do with it, etc. If you use google and look at images that should maybe help a bit.

Explanation:

4 0
3 years ago
Other questions:
  • What is responsible for transport of amino acids to the ribosome during protein synthesis?
    14·1 answer
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • Which of the following statements is true? The Challenger Deep was explored by Picard and Walsh. Data from Jason-1 will help sci
    6·1 answer
  • Which of the following is NOT a program that receives government outlays? A. corporations B. aid programs C. disaster relief D.
    13·2 answers
  • What's photosynthesis and cellular respiration?
    10·1 answer
  • PLEASE HELP!! 50 POINTS!
    10·1 answer
  • Dawn mistakenly took a multivitamin intended for men that contains 90 mg of vitamin C (or 100% of the vitamin C RDA for men). If
    14·1 answer
  • We use heat and additional bacteria to make a cheesefrom yoghurt.
    11·1 answer
  • Before a plant grown in a greenhouse can be planted in a field or garden, it should first be ______off.
    11·1 answer
  • How does the structure of dna affect its function
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!