1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juliette [100K]
3 years ago
13

Which statement is true about lethal alleles?

Biology
2 answers:
timama [110]3 years ago
7 0
They can be maintained in a gene pool if they are expressed before 
<span>reproductive age.</span>


For example:
Sickle cell anemia is caused by an abnormal hemoglobin in red blood cells. hemoglobin is the red pigment found in red blood cells for carrying oxygen.The abnormality arises from a genetic mutation in the DNA gene that codes for the  beta chain of the protein called globin of which hemoglobin is made of.In the beta chain, the sixth amino acid called glutamine is replaced by another one called valine.This one change in the amino acids cause the hemoglobin protein  to behave abnormally, causing  red blood cells to lose their normal spherical shape and become bent like a sickle, hence the name "sickle cell" anemia
enot [183]3 years ago
4 0

Answer:

Last option.  

Explanation:

Lethal alleles can be defined as the alleles that can cause organism's death having lethal alleles. This is because these alleles are resulted from mutations in genes, which are essential for proper growth and development.

Although lethal alleles are harmful, they can be maintained in gene pool if they express in an organism before his reproductive age as mutations can be passed from one generation to other if mutations are expressed in germline cells before reproduction.

Thus, the correct answer is last option.

You might be interested in
Which characteristic do all prokaryotes and eukaryotes share?
Vsevolod [243]
 cells all feature a nucleus, and their organelles are enclosed inside 
4 0
3 years ago
Read 2 more answers
What is the nutrient that helps fulfill a human
bija089 [108]

Answer:

Vitamins, minerals, protein, fats, and more.

Explanation:

7 0
3 years ago
Read 2 more answers
Skeletal muscle tissue can break down glycogen, a carbohydrate polymer, into its individual monomers to be used for energy. What
Lisa [10]

Glycogen is also called as the animal starch. This carbohydrate polymer is made up of the several repeating monomer units (in thousands) of alpha D glucose. The skeletal muscles break down this glycogen into the monomer alpha D glucose units in order to generate energy, which can be used for the contraction and relaxation of the muscle filaments.

Hence, the answer is 'alpha D glucose'.

5 0
3 years ago
1. Pairs of chromosomes with the same traits are called ______________________ pairs. 2. Sex cells, like sperm and eggs, have on
tigry1 [53]
Pairs of Chromosomes are called Sex cell pairs. Sex cells, like sperm and egg, have only a set of Chromosomes called "Daughter Cells". Sorry I didn't do all of your questions, I could only find some of the answers.
7 0
4 years ago
The main function of organelles is
saw5 [17]

Answer:

C. move proteins throughout the cell

Explanation:

My science teacher told me.

4 0
3 years ago
Other questions:
  • I WILL GIVE BRAINLY EST
    11·1 answer
  • Question 4
    13·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • 5. The finches Darwin discovered on the Galapagos Islands are examples of how
    14·1 answer
  • Define synapsis. In what stage does it occur?
    10·1 answer
  • A rocket is launched to a height of 210 kilometers above sea level. What level of the atmosphere has it entered?
    10·1 answer
  • Will using Whole Milk instead of using low
    8·1 answer
  • How to calculate net force
    7·1 answer
  • Please help
    6·1 answer
  • Ron has a gold watch and a silver ring. What can you tell Ron about these items?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!