1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juliette [100K]
3 years ago
13

Which statement is true about lethal alleles?

Biology
2 answers:
timama [110]3 years ago
7 0
They can be maintained in a gene pool if they are expressed before 
<span>reproductive age.</span>


For example:
Sickle cell anemia is caused by an abnormal hemoglobin in red blood cells. hemoglobin is the red pigment found in red blood cells for carrying oxygen.The abnormality arises from a genetic mutation in the DNA gene that codes for the  beta chain of the protein called globin of which hemoglobin is made of.In the beta chain, the sixth amino acid called glutamine is replaced by another one called valine.This one change in the amino acids cause the hemoglobin protein  to behave abnormally, causing  red blood cells to lose their normal spherical shape and become bent like a sickle, hence the name "sickle cell" anemia
enot [183]3 years ago
4 0

Answer:

Last option.  

Explanation:

Lethal alleles can be defined as the alleles that can cause organism's death having lethal alleles. This is because these alleles are resulted from mutations in genes, which are essential for proper growth and development.

Although lethal alleles are harmful, they can be maintained in gene pool if they express in an organism before his reproductive age as mutations can be passed from one generation to other if mutations are expressed in germline cells before reproduction.

Thus, the correct answer is last option.

You might be interested in
Please help I will reward brainliest
Vinvika [58]
It is A. Those are all decomposers, the other answers like C are all animals. Decomposers are are biotic organisms that break down basically dead plants or animals.

8 0
2 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
2 years ago
Height is a polygenic trait in humans. Which of the following statements best explains the genetics of this trait? O Height is c
Alex17521 [72]

Answer: Height is controlled by more than one gene

Explanation:

Polygenic = multiple-gene inheritance. If you break it down into it's roots poly = many and gen = gene, which literally translates to many genes.

6 0
2 years ago
Read 2 more answers
A person wearing a blue shirt is standing in the sunlight. What color(s) of light does the shirt reflect? What color(s) or light
sesenic [268]
The shirt reflects blue and absorbs every other color
6 0
3 years ago
Read 2 more answers
Which is a basic characteristic of all living cell?
Charra [1.4K]

Answer: nucleus

Explanation:

3 0
3 years ago
Other questions:
  • Biology 2, Help Please.
    8·2 answers
  • Pertumbuhan dialami Oleh...
    5·1 answer
  • In the animal kingdom today, poikilotherms outnumber homeotherms by a great margin. Why is poikilothermy a successful way of lif
    8·1 answer
  • A patient is in need of hydration. Which type of solution are the patient’s cells most likely in?
    8·1 answer
  • Cancer cells can reproduce rapidly because they
    10·1 answer
  • Biogeography shows that all camels
    9·2 answers
  • Identify the polysaccharide formed from the enzyme insulin as a means to remove glucose from the blood.
    6·1 answer
  • Match the word to the best sentence.
    10·1 answer
  • These are the 5 main
    14·1 answer
  • HELP ME QUICKKK
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!