1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nimfa-mama [501]
2 years ago
14

You hear rumors about an unusual series of four islands in the Tierra del Fuego archipelago of Chile. On these islands, the typi

cal laws of island biogeography theory are reversed such that species colonization rates are influenced by island size, not isolation, and small islands have higher colonization rates than larger islands. In addition, islands close to the mainland have higher extinction rates than islands far from the mainland. Of the four islands in this archipelago, a _____ island _____ the mainland would have the SECOND LOWEST equilibrium number of species.
Biology
1 answer:
Ronch [10]2 years ago
3 0

Of the four islands in this archipelago, a SMALL island CLOSE TO the mainland would have the SECOND LOWEST equilibrium number of species. Biogeography studies species distribution.

Biogeography refers to the discipline that examines the range of distribution of species and taxonomic groups in a given geographical area over geological time.

The theory of island biogeography is a scientific theory that posits the idea that larger islands exhibit a greater amount of species (i.e., higher biodiversity) than smaller islands.

According to this theory (island biogeography), each island represents a particular unique ecosystem, which is different from other surrounding ecosystems.

Learn more in:

brainly.com/question/905986

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
HELP ILL GIVE BRAINLIEST!! A scientist discovered a new species living in the deep ocean. This organism is prokaryotic, unicellu
Mariulka [41]

Answer:

Kingdom Eubacteria

7 0
3 years ago
A farmer grows beans that he sells to local markets. Over a period of 40
gavmur [86]

Answer:

Selective breeding

Explanation:

3 0
3 years ago
What force causes leaves, rain, and snow to fall to the ground?
Anton [14]

Answer:

Gravity.

Explanation:

Gravity is what causes stuff to fall. It also keeps us on the ground, If there were no gravity, life wouldn’t exist as we know it today. Brainliest please! I need brainlest in order to keep answering questions!!

7 0
3 years ago
Oxygen is required to conduct cellular respiration. <br> true/false?
olga2289 [7]
THE ANSWER WOULD BE TRUE
3 0
3 years ago
Read 2 more answers
Other questions:
  • Enrique examines a plant species to determine whether it could be a pioneer species. Which questions should he ask about the pla
    14·2 answers
  • The infants in the strange situation who waver as they move from mother to toys, are hesitant to explore, are cautious when meet
    12·1 answer
  • A mudflow consists of debris with a large amount of
    12·1 answer
  • Male Japanese quail became sexually aroused by a red light that was repeatedly associated with the presentation of a female quai
    9·1 answer
  • Why lack of vacuole in meristematic tissues
    10·1 answer
  • This carbon compound c2h4 has what type of bond between the carbon atoms?
    9·2 answers
  • You have an experience that causes a complex network of neurons to be built in your brain. This network is most likely a _____.
    14·1 answer
  • PLZ HELP FAST!!!!!
    12·2 answers
  • How are conductors similar or<br>different in how they manage<br>electrons?​
    13·1 answer
  • What tools can be used to make observations of the color of a mineral
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!