1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spayn [35]
3 years ago
6

Aquatic ecosystems consist of two different layers with respect to light. The photic zone is where light penetrates the water, a

t the surface and a little below. The aphotic zone is where the water is perpetually dark because the light cannot penetrate that deep into the water. The zone depths vary due to salinity and clarity of water.
Which of the following must be true about the organisms living in the aphotic zone?
A.
They have all become fluorescent so they can all be seen by one another.
B.
Many organisms have not been able to survive in the cold, dark waters, so population is low.
C.
They have adapted to having no light for an energy source and are able to live in dark and cold areas.
D.
They all must move to the surface of the water once a day to receive adequate light energy.
Biology
1 answer:
muminat3 years ago
8 0
D explain that Ik cuz I did this before
You might be interested in
Sexually transmitted infections (STIs) are a significant problem in the world. The symptoms described in the case thus far are f
lys-0071 [83]

Answer

(From top left to the bottom) Neisseria gonorrhoeae, Herpes Simplex virus, Human papillomavirus (HPV)

(From top right to the bottom) Theponema pallidum, Chlamydia trachomalis, Candida albicans

Explanation:

Neisseria gonorrhoeae: infected individuals may experience pain when urinating or during sexual intercourse. It may be accompanied by unusual discharge (white, creamy or green) from the vagina or penis .

Herpes Simplex virus: causes painful sores around the lips and genitals. These sores are contagious .

Human papillomavirus (HPV): a viral STI, it appears as warts on the male and female genitals when a person is infected. These look like a cluster of pimples

Theponema pallidum: also known as syphilis, it is characterized by painless sores around the mouth or genitals. The sores may later develop into rashes.

Chlamydia trachomalis: may not have any symptoms but if there are any, they include discharge from the vagina or penis .

Candida albicans: is a fungal infection that produces vaginal discharge that looks like cottage cheese .

3 0
3 years ago
What provides instructions to an Eukaryotic cell about living and growing?1.mitochondria2.nucleus3.plasmids4.dna
Vlad [161]
DNA is the answer to your question

7 0
4 years ago
Read 2 more answers
Describe all the ways that a single tree might be involved in the carbon cycle.
avanturin [10]
<span>A single tree absorbs tons of carbon dioxide in its 30-year life cycle and it releases a ton of oxygen. The free nitrogen from the atmosphere is captured by the nitrogen-fixing bacteria and it converts nitrogen into nitrates and nitrites which is then absorbed by the plants. Trees, like all organisms, grow by adding mass (biomass). Carbon is the central ingredient in making that new biomass. Tree biomass is comprised of all parts of the tree; leaves, stems, branches, roots, tree trunks. The biomass of the woody tissue in the tree pictured on the right is made mostly of cellulose, a carbon compound. In a process called carbon fixation, plants transform CO2, an inorganic carbon compound into organic carbon compounds.</span>
4 0
3 years ago
Independent Variable vs. Dependent Variable--Compare Them
Vladimir [108]

Answer:

the independent variable is the Mosquito repellent on the arms The dependent is the amount of mosquito

4 0
3 years ago
Bacteria that contain chlorophyll a belong in the group
galben [10]

Answer:

cyanobacteria

Explanation:

Cyanobacteria /saɪˌænoʊbækˈtɪəriə/, also known as Cyanophyta, are a phylum consisting of free-living bacteria and the endosymbiotic plastids, a sister group to Gloeomargarita, that are present in some eukaryotes.

3 0
4 years ago
Other questions:
  • Part A: List the 9 characteristics of life.
    7·1 answer
  • What is the main reason for the stratification in the north polar waters?
    15·1 answer
  • Which of the following organisms shows a haplonic form of sexual reproduction?
    6·1 answer
  • Unlike most angiosperms, grasses are pollinated by wind. As a consequence, some unnecessary parts of grass flowers have almost d
    13·1 answer
  • Help me write a summary with one of the students best claim!​
    7·1 answer
  • N the 1600s, which scientist discovered microbes in pond water by using a microscope?
    10·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Which is the simplified version of Kepler’s third law when one of the planets being compared is Earth?(1 point)
    15·1 answer
  • When a substantial amount of genetic variation is lost, we call it a
    15·1 answer
  • How has technological advancement have lead to energy crisis? how can judicious use of energy help
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!