It’s D. Carbohydrates are broken down and release ATP energy during cellular respiration.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
dude, you asked brainly the whole worksheet?? Do it yourself sreerag!!
"By growing a bud" is the one way among the following choices given in the question that <span>an adult hydra produce a new hydra. The correct option among all the options that are given in the question is the third option or option "C". I hope that this is the answer that has actually come to your desired help.</span>
Both are organs ur body cant live without thats why when ppl shoot they aim for the heart and/or brain they are vital organs
