1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
salantis [7]
3 years ago
10

For a human zygote to become a fetus it must undergo

Biology
1 answer:
Pavlova-9 [17]3 years ago
5 0

Answer:

B

Explanation:

After fertilization, a zygote undergoes rapid cell division (mitosis) to develop into a foetus

You might be interested in
Need help with these questions answer what you can
OlgaM077 [116]

Answer 1:

The mutation shown is point mutation.

A point mutation can be described as a type of mutation in which only a single nucleotide of a sequence is either:

  • changed
  • added
  • deleted

The addition of the single nucleotide will cause the entire open reading frame to be changed. The amino acid sequence will change entirely from the position where the insertion mutation occurs. This is because the code for making amino acids works on a three base pattern. The reading of the three bases will be altered completely by the addition of just a single nucleotide.

Answer 2:

No, the resulting protein will not be altered.

The genetic code occurs in a linear sequence with triplet format. The change in a single base will cause the wrong amino acids to be formed. However, if the different code is common for the same amino acid then there will be no effect on the amino acid being formed.

<em>For example, the code GUA makes the amino acid Valine. If a mutation occurs and the code becomes GUU instead of GUA, then the resulting amino acid formed will also be Valine. Hence, there will be no alternation in the formation of the protein.</em>

Answer 3:

Melanoma cancer is the type of skin cancer which is associated with cancer from sun light. It is mainly caused due to the harmful ultraviolet rays which act as a mutagen.

<em>The mutations might keep coming back because although the growth have been removed, the other skin cells of the body might still have the mutation in them. As a result, growth will be seen again in the skin cells which might occur again and again. </em>

<em />

Explanation:

7 0
3 years ago
I WILL GIVE BRAINLIEST!!!!!!!!! Name at least three adaptations that allow reptiles to live entirely on land.
kvasek [131]

Answer:

Reptiles have dry, tough skin covered in scales, Reptiles breathe using lungs.  Reptiles’ kidneys concentrate urine.  Young reptiles develop inside an amniotic egg.

Explanation:

good luck :)

3 0
2 years ago
Read 2 more answers
What do scientists know about extrasolar planets? There are very few that are habitable. There are several that have liquid wate
andreev551 [17]
There are likely billions of them in the galaxy
8 0
2 years ago
Read 2 more answers
Which of the following balances is affected by the local force of gravity?
egoroff_w [7]
Analytical balance is your answer 
3 0
2 years ago
Why do you think many world leaders have<br> imposed a ban on human cloning<br> experiments?
Temka [501]
Human reproductive cloning should not now be practiced. It is dangerous and likely to fail.
6 0
2 years ago
Other questions:
  • Cells burn glucose molecules in a process called
    13·1 answer
  • Which of earths spears includes mammals, fishes, and birds
    6·2 answers
  • Which of the following is not a human use of wetlands?
    9·1 answer
  • Meiosis and mitosis are both forms of cell division. However, the outcomes of these processes differ. Consider a diploid organis
    10·1 answer
  • Nucleic acids are composed of smaller molecules. these molecules are called?
    12·1 answer
  • Which of the following occurs during the ecological succession of an ecosystem?
    9·2 answers
  • The texture in the opening phrase of this work is:
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which stage controls the development of a community?
    11·2 answers
  • What is the term for biodiversity that results from few ancestral species
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!