1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
15

Unicellular cells must carry out ___ of life.(1 point) A. all functions B. a few functions C. a single function D. specific func

tions
Biology
2 answers:
DochEvi [55]3 years ago
6 0
Awnser: A all funcions

Explication: unicellular cells carry out all function
Aleonysh [2.5K]3 years ago
3 0

Answer:

all functions

Explanation:

To survive, unicellular cells must carry out all functions.

Hope this helps!

You might be interested in
I don’t get it and I need help and answers please thank you
mrs_skeptik [129]
4. The purpose of having a light source on a microscope is to allow better viewing.
8 0
3 years ago
Does photosynthesis store energy in organic compounds or release energy from organic compounds?
pychu [463]

Answer:

store energy in organic compound

Explanation:

The stored energy is used by the plant for a variety of life processes, such as, growth, reproduction, movement, and repair.

Photosynthesis is the process used by plants to make their own food, by capturing carbon dioxide and sunlight energy from the environment and releasing oxygen. this process occurs in the chloroplast .

3 0
3 years ago
Read 2 more answers
Original Codon: CTC GAG
Vesna [10]

The original codons code for Leucine and Glutamic acid. The mutated codons code for Valine and Glutamine.

<h3>Genetic codes and amino acids</h3>

Each of the genetic codes. otherwise known as codons, translates to an amino acid.

Following the table of genetic codes with their respective amino acids:

  • CTC (CUC) codes for Leucine
  • GAG codes for Glutamic acid
  • GTC (GUC)codes for Valine
  • CAG codes for Glutamine

Thus, the glutamic acid in the original codon has been replaced with glutamine in the mutated codon while Leucine has been replaced with Valine.

More on amino acids can be found here: brainly.com/question/15823799

#SPJ1

5 0
1 year ago
During a hot summer day you noticed your potted plant has wilted and looks droopy and soft. You give it some water and notice th
Bess [88]

Answer:

b

Explanation:

the water gave the plant a drink

8 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • The nuclear envelope disintegrates during _____.
    15·2 answers
  • When one loses weight what happens to biomass lost?
    6·2 answers
  • Use the Internet to research a specific case where radiometric dating was instrumental in a significant archeological discovery.
    10·1 answer
  • The cell's recycling center is the?
    10·1 answer
  • Atelectasis: instructions: definition, clinical manifestations, medication, evaluate the disease power point
    6·1 answer
  • The lac operon is expressed when ________.
    14·2 answers
  • Northern elephant seals were hunted to the point that their population size was reduced to as few as 20 in the late 1800s. Since
    13·1 answer
  • Practice 5: What major feature in DNA makes the organisms look and act differently? Choose the
    9·1 answer
  • Please help :( this is a really complicated question
    7·1 answer
  • The _____ is the center of a stem and can store food. cortex vascular cylinder pith receptacle
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!