1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
15

Unicellular cells must carry out ___ of life.(1 point) A. all functions B. a few functions C. a single function D. specific func

tions
Biology
2 answers:
DochEvi [55]3 years ago
6 0
Awnser: A all funcions

Explication: unicellular cells carry out all function
Aleonysh [2.5K]3 years ago
3 0

Answer:

all functions

Explanation:

To survive, unicellular cells must carry out all functions.

Hope this helps!

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
While Mitosis produces 2 identical cells for growth, repair and replacement, what is the purpose of Meiosis? (Choose 3) a keepin
Sophie [7]

Answer:

Answer is D.Produce non-identical genetically different gametes and reduction of chromosomes,creating a haploid gamete.

Explanation:

Meiosis is essential for sexual reproduction.In humans diploid gamete-mother cells or germ line undergo meiosis to produce haploid gametes.

The chromosomes pairs of each parent undergo crossing over during meiosis.so daughter cells i.e gametes have genetic variations.When gametes  fuse and form zygote ,its genetic make up is different from both parents.thus meiosis allows a species to bring variations in next generations.Benenficial variations help organisms to adapt to the changes in environment.

5 0
3 years ago
Read 2 more answers
What makes life on the Earth possible?
Fudgin [204]

Answer:

Hope it helps

Explanation:

Earth's amazing gaseous atmosphere is responsible for making life possible on this, the third planet from the Sun. Our atmosphere contains water vapor which helps to moderate our daily temperatures. Our atmosphere contains 21% oxygen, which is necessary for us to breathe, 78% nitrogen,

5 0
4 years ago
Read 2 more answers
What is the doctrine of Specific Nerve Energies?
Angelina_Jolie [31]

Answer:

The Doctrine of Specific Nerve Energies has been and continues to be enormously influential in the physiology, psychology, and philosophy of perception. In simple terms, the Doctrine states that we directly perceive in the first instance the activity of our nerves, rather than properties in the external world.

5 0
2 years ago
The economy of agrarian society is based on which of these activities
AleksandrR [38]

Answer: Farming

Explanation: Plowing the land is the  first source of wealth.

7 0
3 years ago
Other questions:
  • How corona virus affected environment?
    9·2 answers
  • The daily value for protein is ____ grams per day.
    9·1 answer
  • Ostriches have wings similar in form to those of their ancestors, but that do not allow the birds to fly.
    15·1 answer
  • Psychologists vary in agreement on the validity of __________. A. social desirability bias B. response bias C. source errors D.
    13·2 answers
  • Which of these might be used to determine common ancestry of two different species of animals?
    13·2 answers
  • Which of the following is the largest of the bundles of tracts that connect the cerebellum to other parts of the brain?
    11·1 answer
  • Which statement identifies an example of a genetic factor that could influence the growth or development of an organism created
    11·1 answer
  • Idea that very small sand grains lead to narrow deep rivers?
    12·1 answer
  • How are unknown minerals identified?​
    13·2 answers
  • If the black horse is homeozygous, what is its genotype?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!