1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vadim26 [7]
3 years ago
14

How are plants pull toward the sun

Biology
1 answer:
yawa3891 [41]3 years ago
5 0

Answer:

Looking for light

Explanation:

Since plants require sunlight in order to produce light, they need to be exposed to it. Now, since there are other plants attempting to do the same they have to grow higher so they don't get put in the others shadow and possibly die due to lack of sunlight.

You might be interested in
Pls answer real quick!!
nadezda [96]

Answer: B. it went faster as time went on

4 0
3 years ago
Weather and climate result from interactions
kifflom [539]
Between the atmosphere and hydrosphere
8 0
2 years ago
Read 2 more answers
Numerous dry salt flats now in existence are the remains of isolated ___ which were left over to evaporate from the salt water.
Neporo4naja [7]
It has to be lakes or rivers
6 0
3 years ago
What does archaeocetes literally mean ?
anygoal [31]

Answer:

ancient whales

Explanation:

3 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • Describe an environmental factor that could influence natural selection and decrease genetic diversity and pick a specific examp
    6·2 answers
  • Which of these organelles is responsible for sorting proteins before they are
    11·2 answers
  • The color of a horse’s coat is determined by its
    9·2 answers
  • The solar system formed from the _____.
    12·1 answer
  • What are three uses that change the land?
    7·1 answer
  • What is a trait in your own words
    5·2 answers
  • What does this sequence What does this sequence illustrate?
    9·2 answers
  • 7. Which is the result of cell division in one-celled organisms?
    13·2 answers
  • In manipulative studies, it is necessary to have an experimental group and a ________ group.
    10·1 answer
  • Describe how energy flows in living things.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!