1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bingel [31]
3 years ago
9

Cual vino primero el topo o el roedor

Biology
2 answers:
wariber [46]3 years ago
8 0

Answer:

We don't truly.

Explanation:

What we do know is that they appeared around the same time on Earth:

Moles were discovered 54.8 million years ago

Rodents were discovered 54 million years ago.

If you want to compare it number wise, then moles came first.

Mandarinka [93]3 years ago
3 0

Answer:

el topo

Explanation:

You might be interested in
Nitrogen fixation is A. the conversion of gaseous nitrogen into an organism friendly form (ammonia (NH3). B. preplanned setting
Stolb23 [73]

Answer:

The correct answer is option A. "the conversion of gaseous nitrogen into an organism friendly form (ammonia (NH3)".

Explanation:

Nitrogen fixation is a biological process at which gaseous nitrogen is converted into an organism friendly form (ammonia (NH3). Nitrogen fixation is performed in nature by microorganisms in the soil. Some of these microorganisms have a symbiotic relationship with plants. These microorganisms convert the gaseous nitrogen into ammonia, which is used by the plant as a source of nitrogen.

8 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Do you think the processes that form and shape the small stream bed are similar to those that form and shape the Grand Canyon? W
NARA [144]

Answer:

Yes.

Explanation:

Yes, the processes that formed and shaped the small stream bed are similar to the process of formation of Grand Canyon because both small stream bed and Grand Canyon formed by flowing of river. Water flows through rocks and finally formed Colorado River. so we can say that both small stream bed and Grand Canyon formed due to the same process i. e. flowing of water.

7 0
3 years ago
The atoms of blue paper _____ blue light. <br> absorb<br> reflect<br> transmit
Mars2501 [29]
REFLECT is the answer
3 0
3 years ago
Read 2 more answers
Leer el siguiente texto de las teorías evolutivas y expresar cuales son las principales semejanzas y diferencias
IceJOKER [234]

Answer:

Lamarck creía que la evolución era una consecuencia de la presión ambiental mientras que Darwin expresó que el mecanismo de evolución es la selección natural

Explanation:

Lamarck desarrolló una teoría en la que propuso que los organismos evolucionaban como una consecuencia de la influencia ambiental y que los cambios fenotípicos causados por el ambiente podía ser trasmitidos a través de generaciones. Por otra parte, Darwin desarrollo una teoría en la cual las especies evolucionan a través de un proceso que él denominó selección natural (supervivencia del más apto) : aquellos organismos mejor adaptados a su ambiente tendrán más chances de sobrevivir y de reproducirse, pasando sus genes a la siguiente generación. En relación al cuadro comparativo, Lamarck creía que las jirafas se adaptaban a su ambiente para sobrevivir, mientras que Darwin propuso que aquellas jirafas que mejor se adaptaban a un ambiente cambiante tenían más chances de sobrevivir. Lamarck también creía en la idea del uso y desuso de órganos: las jirafas con el tiempo podía desarrollar cuellos más largos estirándose para alcanzar las hojas de los árboles de copas más altas y transmitían esta característica a su progenie, mientras que Darwin propuso que aquellas jirafas con cuellos más largos tenían más chances de sobrevivir que las que tenían cuello corto (selección natural), y las jirafas de cuello largo transmitían este rasgo a su descendencia (descendencia con modificación). Lamarck creía en la idea que las especies no poseen un antecesor común, mientras  que Darwin creía que todo el árbol de la vida está conectado a través de antepasados comunes. Finalmente, Lamarck pensaba que las especies no podían extinguirse, mientras que Darwin propuso la idea que las especies se extinguen y surgen otras nuevas a través de procesos de radiación adaptativa.

4 0
3 years ago
Other questions:
  • Why can you predict the base sequence of one strand in a molecule of DNA if you know the sequence of the other strand?
    14·2 answers
  • What is the ethical value of using a model organism, such as zebrafish for doing marine research on pathogens?
    13·2 answers
  • Some will require energy and a transporter protein in the membrane. Amino acids use this form of transport, called ____________
    9·1 answer
  • What is the ratio of surface area to volume for a sphere with the following measurements? Surface area = 588 m2 volume = 1372 m3
    12·1 answer
  • Describe a medical advance that has led to a decrease in the spread of communicable diseases. What is the advance? How does it p
    14·2 answers
  • Ecological succession is typically a _______ process through which a developing ecosystem becomes _______ stable.
    13·1 answer
  • What carries messages away from the cell body
    5·1 answer
  • Can someone help me with these assignments because im having alot of trouble
    6·1 answer
  • scientists have discovered several species of insect that all contain the same DNA sequence on their second chromosome. What doe
    6·1 answer
  • 2. Which of the following are abiotic factors in an ecosystem? (Select all that apply.)
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!