Explanation:
A rock would experience a temperature of 5500°C is about the core which is at a depth of 220km.
But let us use the earth's geothermal gradient to solve this problem.
The geothermal gradient is the rate at which temperature is increasing with depth.
The geothermal gradient 25°C/km
At 5500°C,
5500°C x
= 220km
But this is not so in nature, there are other heat sources that contributes to increasing temperature with depth such as radioactive heat and frictional heat.
learn more:
Mantle brainly.com/question/10758534
#learnwithBrainly
There is no image please add one
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The answer is Cell Membranes.
Let 'C' denote the dominant trait of eye-crossing and 'c' denote the recessive trait of not being able to cross the eyes. The genotype of the father is heterozygous dominant for the trait of eye-crossing. This is denoted by 'Cc'. The mother is homozygous recessive for the trait of eye-crossing, denoted by 'cc'. The mating between the two will result in following genotypes: two of 'Cc' and two of 'cc'. Therefore the probability that the child will be able to cross his or her eyes is 0.5 or 50%.