1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fgiga [73]
3 years ago
8

Reactive oxygen species (ROS) are unstable, or reactive, compounds that result from the partial reduction of oxygen. ROS can cau

se damage to molecules, including membrane lipids and nucleic acids, and may be associated with some diseases. Which of the following compounds are reactive oxygen species? Choose all that apply.
.OH
OH-

O2-
H2O

H2O2

H-
Biology
2 answers:
Lady bird [3.3K]3 years ago
7 0
Do you have any more I fo
Genrish500 [490]3 years ago
6 0

Answer: .OH, O2-, H2O2

Explanation:

Reactive oxygen species (ROS) are chemically reactive and unstable species containing oxygen. ROS are formed when oxygen is partially reduced, thus they are all radicals with very high reactivity, attacking membrane proteins such as ion channels etc

Examples include peroxides (H2O2), superoxide (O2-), hydroxyl radical (.OH)

You might be interested in
How did more sophisticated microscope have allowed scientists to advance their knowledge of cells?
vazorg [7]
<span>because they have an enhanced sight due to the amount of magnification and objective lens</span>
7 0
3 years ago
What characteristics apply to gymnosperms? (Choose all that apply)
Sholpan [36]
Have cones as reproductive structures.
Have vascular tissue.
8 0
3 years ago
A human impact on the nitrogen cycle, such as fertilizer
statuscvo [17]
When a human dies, his corpses gets decomposed by decomposing bacteria. What's produced by the decomposing bacteria is the "fertilizer" for plants.
4 0
3 years ago
Which of the following statements about molecular switches is false?
CaHeK987 [17]

Answer:

(a) Phosphatases remove the phosphate from GTP on GTP-binding proteins, turning them off

Explanation:

  • A molecular switches are molecule that can be reversibly shifted between two or more stable states.
  • The molecules may be shifted between the states in response to environmental stimuli, such as changes in pH, light, temperature, an electric current, micro-environment, or in the presence of ions and other ligands.

4 0
3 years ago
The chloroplasts of flowering land plants typically contain at least two photosynthetic pigments
SashulF [63]

Answer:

Chlorophyll A, and B.

Explanation:

Chlorophyll is known as the green pigment which is present in plants. Through the process of photosynthesis, It helps to convert solar light into useful energy. They have light absorption properties, so they are known as photoreceptors. Mainly two types of Chlorophyll are present in plants:

Chlorophyll A: It Is known as the primary photosynthetic pigment and has the ability to absorbs red, blue, and violet lights. Chlorophyll A is the location of the photochemical processes and can absorb light which is needed for the process of photosynthesis.

Chlorophyll B: It mainly helps to absorb blue light which is utilized to fill out the absorption of chlorophyll A it means it helps to supply additional light energy to chlorophyll A. It is known as the accessory pigment.

5 0
3 years ago
Other questions:
  • An instrument with a longer tube or larger body has a ______ natural frequency.
    7·2 answers
  • Kisspeptin is a protein that, in humans, has an important role in initiating secretion of the releasing factor gonadotropin-rele
    12·1 answer
  • Define trawling, and explain the ecological damage associated with it.
    15·2 answers
  • What is "static pressure" in Hearing Science? <br><br> I will mark brainliest!
    11·1 answer
  • What would happen if a planet weren’t in the Habitable Zone?
    13·2 answers
  • what is wrong with the following statement? "Science has proven that energy must always be conserved."
    5·1 answer
  • Could a person with O+ blood have a daughter with AB+ blood? Explain.
    7·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • A mother with heterozygous type A blood wants to have a baby with type B blood. What blood type for the father would give the ba
    15·1 answer
  • Identify the organelles in the cell to the right.<br> A<br> B<br> C<br> D<br> E<br> F
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!