1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bagirrra123 [75]
3 years ago
5

How does the weather caused by a warm front compare to the weather caused by a cold front

Biology
2 answers:
Harlamova29_29 [7]3 years ago
8 0
Warm fronts cause snow flurries in the winter, while cold fronts cause several days of rainy weather. Warm fronts cause rapid changes in weather, while cold fronts cause several days of cloudy weather. Warm fronts cause thunderstorms in the summer, while cold fronts cause rain when the air is humid.
user100 [1]3 years ago
5 0

Answer:c

Explanation:

because

You might be interested in
Which statement about bones is
SSSSS [86.1K]

Answer:

The correct answer is:

C. Blood vessels run around bones and not through.

4 0
3 years ago
A new drug has been created by altering dna. what process has been utilized to create this drug?
Rama09 [41]

The process of genetic engineering has been utilized to create this drug.

Genetic engineering is the artificial modification of DNA or other nucleic acid molecules in order to alter an organism’s characteristics in a certain way using biotechnology. Genetic engineering is used by scientists to improve or change the genetic makeup of an individual organism and it involves the transfer of genes to create ameliorate organisms.

6 0
3 years ago
Help ASAP PLEASE PLEASE PLEASE PLEASE
disa [49]

Answer:

Explanation:

Ok so it will be the first one but it migt be the second on for the simple fact that they both use CO2 and O2

I might be wrong because i am working on that to in my Bio class

3 0
3 years ago
Which type of competition happens
Furkat [3]

Answer: intraspecific competition

hopes this helps.

5 0
3 years ago
Read 2 more answers
What type of muscle contraction occurs when a muscle is exerting force equal to that placed on it, resulting in no appreciable c
iogann1982 [59]
Volunteers muscle relaxers length
6 0
3 years ago
Other questions:
  • Which of the following organelles can be found in the cytoplasm and in the surface of the ER
    8·1 answer
  • What will happen when the 14 grams of protein in the Greek yogurt is eaten by person
    8·1 answer
  • Motor (efferent) neurons carry information _____ the brain whereas sensory (afferent) neurons carry information ______ the brain
    8·1 answer
  • Caffeine is an inhibitor of phosphodiesterase. Therefore, the cells of a person who has recently consumed coffee would have incr
    6·1 answer
  • A group of plant cells was exposed to radiation, which damaged the chloroplasts and caused them to lose function. If the mitocho
    5·1 answer
  • plate tectonics can help explain which of the following a. ocean currents b. weather systems c.land errosion d. trenches
    12·2 answers
  • The diagram shows the karyotype of a female with Patau syndromePatau syndrome is known as trisomy 13 and is caused by the presen
    11·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • A car moves when filled with fuel and the engine is started by the driver. It changes direction on its own when the steering whe
    9·2 answers
  • 4. Which of the following is NOT a way that viruses are classifieda. Shapeb. Sizec. Kingdomd. Host
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!