Which organelle helps cells in all the animals shown in the food web transport proteins?

1 answer:

3 0

The endoplasmic reticulum, or ER, and Golgi apparatus, prepare molecules, including proteins, hormones and lipids, and package them in vesicles for transport. Rough ER is studded with ribosomes that synthesize proteins, while the smooth ER manufactures lipids.

You might be interested in

Scientist have discovered fossils on an island what type of rock for the most likely examining

Lena [83]

It is either Igneous rock or Sedimentary rock. But if I were to choose one, I would choose Igneous.

8 0

3 years ago

Mountain ranges form along ___ plate boundaries via orogenic processes.

Tamiku [17]

1. Mountain ranges form along convergent plate boundaries via orogenic processes.

<h3>What is tectonic plates?</h3>

The formation of mountains is caused by tectonic plates. A mountain is formed when two tectonic plates move towards each other and collide, resulting in altitudes that can take years to reach but that eventually create massive mountains through what are known as convergent plate borders.

2. Rift valleys formed through the stretching of divergent plates occurs through a divergent boundary process.

When tectonic plates separate, they can leave low ground areas like the Rift Valley, which are produced by diverging continental plate borders. They can be found on the surface of the Earth or at the bottom of the ocean, and they are formed by the expansion of the seabed.

3. The formation of mountain ranges occurs as a result of orogeny.

This process occurs when one continental plate dips and the other rises, allowing mountain ranges to form. Orogeny is the name given to this process.

4. Scientists observe an extremely long deformation area in a continental plate during an orogenic process..

Scientists use tectonic plate simulations to study this deformation in order to better predict natural disasters such as earthquakes.

5. Epeirogenic process causes vertical plate motion along tectonic plates.

The vertical movement of a continent that generates soft arcs or rises parts uniformly is known as epeirogeny.

For more information regarding tectonic plates, visit:

brainly.com/question/2325633

#SPJ1

3 0

1 year ago

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the

Ierofanga [76]

3’ tcgccctactcgcgtacaccgcgtattgac 5’ turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)

6 0

3 years ago

What is the greatest issue facing society that results from the development of new applications of cell technology?

Mice21 [21]

How to balance an iduviguals rights with meeting the needs of socity

8 0

2 years ago

Read 2 more answers

number the steps in the correct order to describe how bees collect pollen and nectar to feed the hive and, in the process,helps

Free_Kalibri [48]

Bees go out of the hive in search of flowers with nectar by sensing static electric zaps with there small hairs. When they do find a flower they land and start sucking up the nectar in the process pollen falls on their coat and they carry it to the next flower to suck nectar from. the nectar is brought back to the hive inside the bees and is thrown up as honey wich the lave eat and if a lave is to become a queen they are fed royal jelly. Royal jelly is a white secretion produced by young female worker bees. It is comprised of pollen and chemicals from the glands of worker bees.

7 0

2 years ago