1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KIM [24]
3 years ago
14

Which adaptation would be the most beneficial for an animal that lives in the tundra?

Biology
2 answers:
pav-90 [236]3 years ago
8 0
The answer would be thick fur. It would provide warmth. Hope this helps!
gizmo_the_mogwai [7]3 years ago
6 0

Answer:

Thick fur

Explanation:

Tundra region experiences has very cold climate with very less precipitation making the life difficult in that region. The organisms living in the Tundra region is adapted to live in that harsh cold climatic condition. The adaptations include two layers of thick fur, dense hair and extra layers of fat called blubber to keep them insulated from extreme cold.

You might be interested in
Which would have the greatest potential energy?
dimaraw [331]

Answer:

B-45lb dog in an oak tree

Explanation:

7 0
3 years ago
This green pigment found in plants traps energy from the Sun for photosynthesis.
34kurt
Chlorophyll is the answer I am 100% sure
6 0
3 years ago
Read 2 more answers
ANSWER QUICK PLEASE
Y_Kistochka [10]

Answer:

similar halves on each side of a single plane

Explanation:

8 0
3 years ago
Read 2 more answers
Thinking and acting strategically in healthcare is important because
Afina-wow [57]
This can provide a direction to give the appropriate and best management to the patient. THis can enhance the quality of healthcare and reduced the erroneous work which can be dangerous or fatal to the patients. Provide access to care and contain the cost of health services. This can be achieve with the use of intuitive thinking, leadership and learning from previous experiences. This can be combined for an effective approach.
5 0
3 years ago
Look at this diagram representing asteroids and planets orbiting the sun.
viktelen [127]
There is no diagram?dudidjdjdjdd dhhdjdd
8 0
3 years ago
Read 2 more answers
Other questions:
  • What is the term used to describe when the population growth is at a level that can't sustain any more growth because there are
    14·2 answers
  • Which relationship best demonstrates cooperation between species?
    15·2 answers
  • Energy in an ecosystem flows directly from
    10·2 answers
  • The rate at which a parent atom creates daughter atoms is always _____. unstable and changing constant and unique unstable and r
    7·1 answer
  • What is the function of a whales tail
    6·2 answers
  • Please read all this and and answer number 1
    7·1 answer
  • Which of the following substances is formed during photosynthsis hurry please thx​
    8·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Ricky notices a similarity between a fried egg and the diagram of a cell, which cell organelles is Ricky likely to associate wit
    7·1 answer
  • What is a group of similar cells that perform the same function?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!