1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrews [41]
3 years ago
12

Which of the following is false?

Law
1 answer:
Charra [1.4K]3 years ago
8 0

Answer:

Under GAAP, deferred taxes are reported based on the classification of the asset or liability to which it relates.

Explanation: Deferred income tax is a balance sheet item which can either be a liability or an asset as it is a difference resulting from recognition of income between the accounting records of the company and the tax law because of which the income tax payable by the company is not equal to the total expense of tax reported.

Generally, the classification of a deferred tax account as current or noncurrent hinges on the classification of the asset or liability that gave rise to it. Any deferred tax account not arising from a specific asset or liability is classified as current or noncurrent based on its expected reversal date.

You might be interested in
If someone changes in prison and simply becomes a “better person,” not necessarily changes to make a difference in the larger wo
Elis [28]

I would say they should be spared from death, but not be given freedom if they have gotten the death penalty they should stay in a prison for life with no chance of parole but still have visitors and phone calls

You can determine if a person has changed by running a series of test like a self evaluation and a psychiatric evaluation and the change to repent there action and admit

3 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Forensics Questions 1 and 2
g100num [7]
1. I would maybe match the two samples by the tone of their writing? I know it doesn’t make sense but maybe look for clues of their vocabulary or how they describe things. I will also check for the size of the two writings or see any similar details.
4 0
3 years ago
A debt issued by a company as a negotiable instrument with a term of 9 months or less is a security that is exempt from registra
Tomtit [17]
The answer would be B
7 0
2 years ago
Read 2 more answers
Which of the following is not a requirement of a complaint? A. It must be accompanied by an affidavit. B. It must allege suffici
andrezito [222]
RESPUESTA:
Inciso(D)
EXPLICACION:
NONE XD

5 0
3 years ago
Other questions:
  • Which illustrates the proper outline for a judge's opinion on a case?
    11·1 answer
  • One reason for the failure of SA
    12·2 answers
  • The Virginian General assembly passes constitutional legislation who ratifies it
    10·1 answer
  • 3<br>Миллиграммен өрнектеп, өсу ретімен жаз.<br>5г 200 мг<br>3г 61 мг<br>4г 35 МГ<br>1 кг 20 г​
    15·1 answer
  • All elements of an offense have to be proven before someone can be charged with the crime.
    13·1 answer
  • Does the definition of first-degree murder vary from state to state? Explain your answer
    10·2 answers
  • Which early US
    15·1 answer
  • “He [the President] shall have Power, by and with the Advice and Consent of the Senate, to make treaties, provided two thirds of
    12·1 answer
  • Who is granted u. S. Citizenship by the fourteenth amendment to the u. S. Constitution?.
    10·1 answer
  • Stacy is a fraud examiner working on a case with international participants. which agency maintains a database that might help h
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!