1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elden [556K]
3 years ago
14

A ____ is the name for ALL organisms that get their nutrients and energy from other organisms. A. parasite B. heterotroph C. fun

gi D. none of the above
Biology
2 answers:
scoundrel [369]3 years ago
8 0

Answer:

B. Heterotroph

Explanation:

Heterotrophs are the organisms that cannot make their own food by simpler elements and derive their nutrition from autotrophic plant and other animals. Heterotrophs include saprotrophs (that feed on dead organic matter), parasites (that derive their nutrition from living tissues of other organisms) as well as decomposers. Some of the examples of heterotrophic organisms are fungi, human and all animals.

Tom [10]3 years ago
3 0
The name for all organisms that get their nutrients and energy from other organism are called parasites.
You might be interested in
The B horizon is ____.
Alexus [3.1K]
<span>less nutrient rich than the A horizon</span>
6 0
3 years ago
Read 2 more answers
How does a cell avoid dna overload
lora16 [44]

Answer:

the anwer is  cell divides

Explanation:

8 0
2 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
This means to move around. An organism must do this to find food, shelter, and space.
bezimeni [28]
Hunting, I believe. Hope this helped
3 0
3 years ago
Read 2 more answers
Which of the following could be included in a good conclusion
anygoal [31]

Answer:

um dunno what the answer choices are so here

  • Include a brief summary of the paper's main points.
  • Ask a provocative question.
  • Use a quotation.
  • Evoke a vivid image.
  • Call for some sort of action.
  • End with a warning.
  • Universalize (compare to other situations).
  • Suggest results or consequences.
6 0
2 years ago
Other questions:
  • How can farmers keep topsoil on their land?check all that apply.
    6·1 answer
  • How do you do Balencing equations.
    7·1 answer
  • The molecule ATP is composed of elements that are usually found in organic molecules. Which of the following is one of the eleme
    8·2 answers
  • To determine how a flowering plant is pollinated, which structure or feature would be most important to examine?
    8·1 answer
  • What is the LARGEST mammal in the world?
    14·2 answers
  • if a certain tissue of the body needs more energy, which organelle is more likely to abundant in the cells of this tissue? eluci
    11·1 answer
  • Sections of mRNA that are kept and ultimately code for proteins are called:
    8·2 answers
  • I need help with this waves assessment!!!
    11·2 answers
  • Please help!!!!!!!!!!!!!!!!!!!!!!
    15·2 answers
  • Recessive traits are...
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!