1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gogolik [260]
3 years ago
14

Where do producers get their energy?

Biology
2 answers:
GaryK [48]3 years ago
8 0
The answer is <span>from the D.sun by absorbing the light through their leaves



Hope its help?</span>
Shtirlitz [24]3 years ago
4 0
They get their energy from the sun so your answer will be D. 
You might be interested in
1 These are known as little organs
pav-90 [236]

Answer:

C-Organelles

Explanation:

3 0
3 years ago
Read 2 more answers
Being able to readily diffuse material through itself, such as occurs in alveoli, is a characteristic of which type of epithelia
Karolina [17]

Answer: Simple squamous epithelium

Explanation:

The simple squamous epithelium can be define as the layer of flat cells which can be found in contact with the basal lamina. This layer is permeable to allow the molecules to pass through the membrane for diffusion and filteration.

The diffusion of carbon dioxide and oxygen from the membrane of epithelia is also facilitated by the simple squamous epithelium.

7 0
3 years ago
Read 2 more answers
mbb347 considering the dna fragments in the ligation reaction list all of the possible ligation products that could occur. which
Fed [463]

mbb347 considering the DNA fragments in the ligation reaction list all of the possible ligation products that could occur. Gene segment and PCR of these products will confer kanamycin resistance in transformed bacteria.

Three pathways are thought to be responsible for bacterial resistance to kanamycin. One technique involves a transposon-borne aminoglycoside-modifying enzyme.

  • Specific rRNA methylation is the second pathway. The cause of kanamycin resistance was modification of the rRNA at position 1405 or 1408. An antibiotic used to treat tuberculosis and severe bacterial infections is kanamycin A, sometimes known as kanamycin.
  • Antibiotic usage is the primary contributor to antibiotic resistance. While some bacteria die when humans take antibiotics, resistant bacteria can live and even proliferate.
  • Antibiotic usage increases the prevalence of microorganisms with resistance. Bacteria have a greater probability of developing antibiotic resistance the more frequently we use antibiotics.

To learn more about  kanamycin.

brainly.com/question/28444685

#SPJ4

6 0
1 year ago
The process by which modern organisms have descended from ancient organisms
n200080 [17]
I believe it is called evolution and you can see this with a genetics tree
7 0
3 years ago
Read 2 more answers
Marsha is eating a chocolate bar that contains hazelnuts and other ground nuts. However, as the bar has a bad taste, she stops.
ankoles [38]
Most probably mould type of fungus must have infested the nuts... the type we see if bread is left open
7 0
3 years ago
Read 2 more answers
Other questions:
  • Damage to the liver might impair enzymatic degradation of some hormones. the levels of such hormones in the blood would therefor
    12·2 answers
  • Which best describes why the cell membrane is selectively permeable?
    7·1 answer
  • Pode esterilizar plásticos na estufa?<br> Pode esterilizar vidros na autoclave?
    5·1 answer
  • What commonally do all flowering plants share with all nonflowering plants?
    14·1 answer
  • Which might be a cause for the increase in songbirds at the feeders?
    8·2 answers
  • What is the name of the small piece of cartilage at the bottom of the sternum
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which food item contains a lot of processed simplw surgars
    5·1 answer
  • How does the study of genetics and DNA help the study of evolution
    12·1 answer
  • PLZ HELP ASAP!!!!!! What are the organisms still alive that display some of the earliest vertebrate evolutionary characteristics
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!