1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bekas [8.4K]
3 years ago
13

What things made of atoms do you see in the video

Biology
2 answers:
kenny6666 [7]3 years ago
4 0

Explanation:

All substances of matter are made up of atoms. Atoms are the smallest indivisible particles that makes up matter.

Elements, molecules, compounds and mixtures are all combinations of different atoms.

An atom in itself is made up three important fundamental sub-atomic particles which are protons, neutrons and electrons.

From the video, any form of matter seen is made up of atom. Matter is anything that has weight and occupies space.

Learn more:

John Dalton brainly.com/question/1979129

#learnwithBrainly

satela [25.4K]3 years ago
3 0

Answer:

Everything in the video including the whale and the water is made up of atoms.

Explanation:

This is because everything is made up of atoms

You might be interested in
Choose all the answers that apply.
____ [38]

increase because of carbon

4 0
3 years ago
Read 2 more answers
#<br> X<br> What phase is represented?
Rufina [12.5K]
Metaphase 2

Hope it helps
8 0
3 years ago
What refers to the amount of a substance in a given space
IrinaVladis [17]

Volume? Is that what you mean?

5 0
3 years ago
What are the relative ages of volcanoes in a chain with a hotspot at one end?<br> Explain
seraphim [82]

Answer:

Mantle plumes that form hotspots are thought to be relatively stationary whereas the overlying tectonic plates typically are not. Thus, as a plate moves over the location of a plume eruption, it carries successively older volcanoes with it.

4 0
2 years ago
Read 2 more answers
What is the base pairing rule for dna?
Alik [6]
Adenine pairs with thymine (or uracil), and guanine pairs with cytosine.
6 0
3 years ago
Read 2 more answers
Other questions:
  • Mr. trumph loses his yacht in a poker game and experiences a sudden onset of chest pain which radiates down his left arm. the pa
    9·2 answers
  • Occasionally, some lethal allele (like sickle cell) is unusually common (more than 50% heterozygotes). what does this tell us?
    8·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Selective cutting is preferable to clear-cutting because it _____.
    8·2 answers
  • If blood is in short supply, which blood type would be the most beneficial to have on hand if someone needed a blood transfusion
    6·2 answers
  • The plasma membrane(cell membrane)is made up of a(n)
    15·1 answer
  • Imagine a scenario where Barr bodies are not due to random inactivation, but rather, the silencing is due to paternal imprinting
    9·1 answer
  • During capillary exchange , what substance is not sent out to the tissue
    10·1 answer
  • Approximately how much of Earth’s surface is water? 100% 75% 50% 25%
    7·2 answers
  • What do proteins do in the body?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!