1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Veseljchak [2.6K]
3 years ago
15

How does the environment change before a squrrel decides to build a nest?

Biology
2 answers:
fiasKO [112]3 years ago
7 0
Because the environment is faster then the squrrel has to find stuff for the nest and a safe spot
NARA [144]3 years ago
4 0
There are more items in their natural spot before the bird comes and takes them to build his nest
You might be interested in
How does capillary action help sustain life on earth? Uptake of food and water by plants Change in climates Water strider walkin
frez [133]
Capillary action is a combination of the adhesive and cohesive properties of water in which the water is able to move up a small tube against the pull of gravity. Therefore, the uptake of food and water is due to capillary action.

Change in climate has nothing to do with adhesion and cohesion in water. Some insects can walk on water due to surface tension, which is due to cohesion. However, there is no movement upward through a tube with surface tension, and so it is not an example of capillary action.

Hope this helps! :)

5 0
3 years ago
Ovulation typically occurs ________ days before the menstrual period begins. question 90 options: 7 10 20 14
Amanda [17]
It occurs 14 days before the menstrual s
cycle
8 0
3 years ago
Read 2 more answers
What is the meaning of prey
kondaur [170]

Answer: an animal that is hunted and killed by another for food.

Explanation:

4 0
3 years ago
Read 2 more answers
An alien race known as the Wombatian Wilburys has the same genetic structure as humans (i.e., same genomes). Interestingly, the
lidiya [134]

reehshsusjwneueusnenshahahananwhwjwu2uwuw

3 0
3 years ago
Explain how water waste can be turned into drinking water
9966 [12]

thats dirty bruh but you could filter all the dirty stuff out and reuse the water



4 0
2 years ago
Other questions:
  • To treat viruses the patient is injected with
    11·2 answers
  • An example of a nonspecific defense provided by the skin is
    7·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • At wich point in the eukaryotic cell cycle does mitosis occur
    8·2 answers
  • Harry suffers from cystic fibrosis and frequently has periods where he can hardly breathe. the problem is most likely the result
    15·1 answer
  • Incomplete Dominance and Codominance You are studying leaf development in a member of the mustard family. You identify several m
    9·1 answer
  • Which description distinguishes the process of meiosis from mitosis?
    7·1 answer
  • Migratory orientations within a species are __________.
    7·1 answer
  • 2. The mother is blood type O and the father is blood type A.
    10·1 answer
  • What bacteria structures can make bacteria RESISTANT TO ANTIBIOTICS. CHOOSE ALL THAT APPLY.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!