<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
genome, cloning
Explanation:
Bacterial plasmids carry a genome against a specific antibiotic. The process whereby bacterial cells take up the plasmid with the resistance gene is called cloning.
The answer to this question is A. A simple Google search will help you find the answer. But, straightforward. That's what he stated in the document he made as the third law. So, that's the answer. Period.
<span>Three fossil fuels are, natural gas, coal and oil
I guess what could differentiate them is that: </span>Coal is a solid fossil fuel formed over millions of years by decay of land vegetation. When layers are compacted and heated over time, deposits are turned into coal. Whereas Oil is a liquid fossil fuel that is formed from the remains of marine microorganisms deposited on the sea floor and gas like oil, it is formed from the remains of marine microorganisms.<span>
So the difference could be how they are formed</span>
