1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
In-s [12.5K]
3 years ago
7

Which structure can be used to differentiate eukaryotic cells from prokaryotic cells?

Biology
2 answers:
diamong [38]3 years ago
7 0
I think the answer is C
Anuta_ua [19.1K]3 years ago
4 0
C- nuclear hope it helps
You might be interested in
Is this correct? <br> LOOK AT IMAGES!!!
Katarina [22]

Answer:

i think the second question is the answer in the middle, im not sure about the first one.

Explanation:

4 0
2 years ago
Read 2 more answers
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
The diagram below illustrates asexual reproduction in bread mold. Reproductive structures known as spores were released from bre
GrogVix [38]
1.) The genetic information will be identical as this is asexual reproduction.

2.)They can spread more efficiently in the sense that the Wind can carry them for miles

Hope I helped
3 0
4 years ago
Once you notice that someone seems to be considering to jump off a building, what is the next step you should take?
Lubov Fominskaja [6]
B, do you have a tutoring option on your account?
8 0
3 years ago
Hemlocks are a common type of tree in the northern forests of the United States. In studying one forest, a forester noticed that
jeyben [28]
D, B, and C are correct. Hope this helps you! Good luck! :)
3 0
4 years ago
Read 2 more answers
Other questions:
  • Swaziland has the highest hiv prevalence in the world: 25.9% of this country's population is infected with hiv.66 the elisa test
    5·1 answer
  • The most reasonable explanation for why energy conversions are necessary is because _______. Select one: a. different types of w
    15·1 answer
  • Explain why DNA occurs in triplet form
    7·1 answer
  • Which should be used to collect fresh liquid blood evidence at a crime scene?
    14·1 answer
  • Automobiles cause air pollution when they burn gasoline. Laws have been passed to make automobile manufacturers limit the amount
    7·1 answer
  • How many breeding pairs are there?
    8·1 answer
  • What is one reason some leaves are spiny or needle shaped
    6·1 answer
  • Which organisms shown in the table belong to the kingdom Plantae?
    13·1 answer
  • Carbon cycles through the biosphere in all of the following processes EXCEPT
    13·1 answer
  • ¿Qué es la energía solar?​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!