1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
raketka [301]
3 years ago
15

Disadvantages of prokaryotic cells

Biology
1 answer:
SSSSS [86.1K]3 years ago
8 0

Answer:

Attached is an image go help you with this.

You might be interested in
The Graph below shows the changes in the population size of sea urchins measured in numbers of sea urchins over weeks of time. A
S_A_V [24]

Answer:

1000

Explanation:

7 0
3 years ago
What might occur when mitosis is not stopped or occurs quickly due to the presence of cancer.  
leva [86]
In a cell, there are several parts of it that are there to stop this from happening. Cancerous cells do not have the genetic code to stop growing and reproducing. A regular cell will actually destroy itself it there is a mutation. If it does not get destroyed, it could potentially be tumorous, then it could eventually be cancerous.

4 0
3 years ago
What types of bonds does metalloid form?
Sati [7]

Answer: Metalloid and non-metals not only form covalent bonds by sharing, but can form ionic bonds either by losing or gaining electrons

Hope this helps

Explanation:

7 0
2 years ago
1. which pairing matches the structures shown in the cell diagrams with th
Mademuasel [1]

Explanation:

D. E: photosynthesis; D: cellular respiration

Photosynthesis is a chemical pathway that’s integral to producing energy in plants and other primary producers. Energy in the form of molecules of glucose is produced from light, water and carbon dioxide while oxygen is released. This occurs in several complex steps, photosynthesis is a rate limited reaction, depends on several factors including carbon dioxide concentration, ambient temperature and light intensity; the energy is retrieved from photons, I.e. particles of light, and water is used as a reducing agent.

In the light reactions, occuring within the thykaloid, and stroma of the chloroplasts, water supplies the pigment chlorophyll with replacement electrons for the ones removed from photosystem II. Additionally, water (H2O) split by light during photolysis into H+ and OH- acts as a source of oxygen along with functioning as a reducing agent; it reduces the molecule NADP to NADPH by providing H+ ions. NADP and NADPH are integral to the dark reactions, or Calvin cycle where monosaccharides or sugars like glucose are produced after the modification of several molecules.

Respiration in the mitochondria utilizes oxygen for the production of ATP in the Krebs’s cycle via the oxidization of pyruvate (through the process of glycoysis). The electron transport chain, in which oxygen functions as the terminal electron acceptor, occurs in both plants and animals. Respiration includes:

  • Glycolysis: occurs in the cytoplasm 2 molecules of ATP are used to cleave glucose into 2 pyruvates, 4 ATP and 2 electron carrying NADH molecules.
  • The Kreb's cycle: in the mitochondrial matrix- 6 molecules of CO2 are produced by combining oxygen and the carbon within pyruvate, 2 ATP oxygen molecules, 8 NADH and 2 FADH2.
  • The electron transport chain, ETC: in the inner mitochondrial membrane, 34 ATP, electrons combine with H+ split from 10 NADH, 4 FADH2, renewing the number of electron acceptors and 3 oxygen; this forms 6 H2O, 10 NAD+, 4 FAD.

Learn more about cellular respiration at brainly.com/question/11203046

Learn more about Photosynthesis at brainly.com/question/4216541

Learn more about cellular life at brainly.com/question/11259903

#LearnWithBrainly

6 0
3 years ago
What sense organs are located on the head and in the mouth of a fetal pig?
Ratling [72]
The sense organs that are located on the head and in the mouth of a fetal pig are the Ears, mouth, eyes, nose, and tongue. The pig, just like humans, experiences sound, sight, taste, smell, heat, cold, pain and also balance. The way it responds to these assists humans in the recognition of health and diseases. For instance pain and the posture will often indicate a specific disease such as a fracture of the vertebrae in the spine.
3 0
3 years ago
Other questions:
  • 80%
    8·1 answer
  • A client with type 1 diabetes presents to the diabetes educator and asks about a change in insulin. The client's occupation requ
    6·1 answer
  • In the nitrogen cycle, bacteria that live in soil and on plant roots in a symbiotic relationship with legumes change nitrogen ga
    10·1 answer
  • Coin tosses can demonstrate the effects of genetic drift. Imagine that heads and tails are two alleles in a population. Consider
    9·1 answer
  • A moss-covered log is overturned by a hungry bear looking for insects to eat. The bear disturbs an ant colony, and some chipmunk
    8·1 answer
  • Compare the age of ocean rocks to that of continental rocks. How does this difference support the idea of seafloor spreading?
    7·1 answer
  • Farm pig name ideas for girl and boy please. Thanks so much
    9·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • MCQ ...help me........​It's a last question
    14·1 answer
  • Besvara följande frågor med hjälp av läroboken.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!