1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
3 years ago
15

What is the function of cartilage in adult bones?

Biology
2 answers:
d1i1m1o1n [39]3 years ago
8 0

Answer:

preventing friction between bones

velikii [3]3 years ago
5 0

The correct answer is B. Preventing friction between bones

Explanation:

Cartilage is a soft, and elastic tissue that protects the end of bones in articulations; although this tissue also forms structures such as the ear. In the case of cartilage in bones, the main function of this is to act as a protector for the bones by reducing the friction between them. For example, cartilage is found in the joints. This is necessary because bones are hard structures and direct friction between them would lead to deterioration of the bones. According to this, the main function of cartilage is preventing friction between bones.

You might be interested in
2-In what way is nitrogen important to life on Earth?
Anna007 [38]
I believe all of the above!
8 0
3 years ago
Read 2 more answers
Which of the following is a decomposer? A. Grasshopper B. Sunlight C. Tadpole or D. Earthworm
romanna [79]

Earthworms are decomposers



5 0
3 years ago
Read 2 more answers
you decided to make bread you mix together the yeast mixture and set it on the table overnight but when you wake in the morning
katovenus [111]
This question would be better placed under the Chemestry section
4 0
3 years ago
Why is the cell membrane said to be selectively permeable
Pachacha [2.7K]

Cell membrane allows some material to pass through it while on the same time it blocks other material from entering through it

5 0
2 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement is correct? The two tiles are not similar because segment SP is to segment SR is 4 : 7 and segment MJ is to segm
    9·2 answers
  • Help ASAP<br>What is the FUNCTION OF THE SETAE?
    13·1 answer
  • What process takes small molecules and puts them together to form macromolecules
    11·1 answer
  • List of organs in the cardiovascular system
    13·1 answer
  • What happens to E. coli when lactose is not present?
    13·2 answers
  • Ligands (molecules that bind) such as insulin bind to receptors in a reversible manner. what properties of noncovalent bonds len
    9·1 answer
  • What best describes the types of organsisms found in esturaries
    10·2 answers
  • In the process of carbon fixation, three molecules of RuBP combine with three molecules of CO₂ to produce three six-carbon molec
    9·1 answer
  • Once a cell becomes specialized, can it become any other type of cell? explain.
    15·1 answer
  • What atoms make up sugar molecules, amino acids, and fatty acids?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!