1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnom [1K]
3 years ago
13

In testing the hypothesis, research observations have shown a direct relationship between higher sodium intake and higher blood

pressure across population groups.
a. True
b. False
Biology
1 answer:
Alina [70]3 years ago
8 0

Answer:

True.

Explanation:

The sodium is necessary for the proper functioning of body and maintains the electrolytes balance of the body. The sodium is also important for the conduction of nerve impulse.

Research has tested the hypothesis in the population and found that the higher sodium intake increases the blood pressure of the organism. High amount of sodium also increases the heart related disease in the individual.

Thus, the correct answer is option (a).

You might be interested in
hich of the following describes the structure and function of the cell membrane? A. The hydrophilic head groups of the lipid mol
jeka57 [31]

The correct answer is: A. The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell and the cytoplasm, which is a water-like environment. The hydrophobic tails form an oily layer inside the membrane that keeps water out of the cell.

Plasma membrane of the cell is arranged in a bilayer of phospholipids. Phospholipids are amphipathic molecules which means that they have both hydrophilic and hydrophobic regions. The hydrophilic heads of phospholipids that are faced outward and hydrophobic layer located in the interior of the bilayer together make a good barrier between the interior and exterior of the cell, so the water and other polar or charged substances cannot easily cross the hydrophobic core of the membrane.


5 0
3 years ago
Read 2 more answers
Of the four avenues of poisoning, generally ___________ is the most worrisome in terms of treatment to the ems provider.
shusha [124]
Of the four avenues of poisoning, generally, injection is the most worrisome in terms of treatment to the EMS provider. Emergency care for patient who has been poisoned may include a range of actions from reassuring an anxious parent to instituting CPR. The most important treatment for poisoning is diluting and/or physically removing the poisonous agent. How you do this depends on how the poison gets into the patient's body in the first place. 
4 0
3 years ago
In humans blood type is determined by the A, B, and O alleles. The A and B alleles are codominant to each other and dominant ove
Komok [63]

I'm taking an educated guess of A or B.

7 0
4 years ago
When an organism's weight falls below its set point, the organism is likely to experience a(n) ________ hunger and a(n) ________
UNO [17]

Answer:

When an organism's weight falls below its set point, the organism is likely to experience a(n): <u>increase</u> in hunger and a <u>decrease</u> in its basal metabolic rate.

6 0
4 years ago
Which of the following is a biotic factor in an ecosystem?
eimsori [14]
Answer

D. Light from sun
4 0
3 years ago
Other questions:
  • What percentage of the offspring in each scenario would have sickle-cell disease? what percentage would have sickle-cell trait?
    11·1 answer
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • imagine a cell-surface receptor protein is being newly synthesized. How can it get into the membrane that it will ultimately be
    7·1 answer
  • WILL GIVE BRAINLIEST
    14·2 answers
  • The type of anemia that is seen in severe folate deficiency is characterized by large, immature blood cells. This type of anemia
    8·1 answer
  • Molecules with a relatively high lipid solubility are capable of crossing the membrane
    13·2 answers
  • Which mineral will scratch fluorite, galena, and pyroxene?
    15·1 answer
  • Infinity of biology ​
    14·1 answer
  • PLEASE HELP WILL GIVE BRAINLIEST IF CORRECT
    11·1 answer
  • PLS ANSWER AS SOON AS POSSIBLE
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!