1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tom [10]
3 years ago
14

PLEASE HELP ME

Biology
2 answers:
denis-greek [22]3 years ago
6 0

Microtubules form the internal structure of both cilia and flagella. These assist in cellular motion.

Sidana [21]3 years ago
5 0
The answer is C) microtubules
You might be interested in
The client is taking cyclobenzaprine for muscle spasms secondary to an injury to the lumbar spine that occurred while lifting a
Dima020 [189]
Cyclobenzaprine is a drug that produce an anticholinergic response in the body, which means that is blocks neurotransmitters from the nervous system to prevent things like muscle spasms. but due to the neurotransmitters being blocked, it can cause these kinds of side effects because the brain can no longer control these things.
let me know if you have any further questions
:)
3 0
3 years ago
A cold transmitted by a facial tissue is an example of fomite. vehicle transmission. droplet transmission. vector. direct contac
m_a_m_a [10]

Answer:

Direct contact.

Explanation:

Since it was spread through facial tissue, physical contact is needed.

Hope this helps! :)

4 0
3 years ago
How do plasma cells form, and how do they help fight pathogens
xz_007 [3.2K]
<span>Plasma cells, they are also called  plasma B cells,  or effector B cells, are white blood cells that secrete large volumes of antibodies. They are transported by the blood plasma and the lymphatic system. Plasma cells originate in the bone marrow; B cells differentiate into plasma cells that produce antibody molecules closely modeled after the receptors of the precursor B cell. Once released into the blood and lymph,</span>
5 0
3 years ago
Read 2 more answers
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Among the following scientists, which one is known for developing the laws of heredity?
Alexus [3.1K]
Among the following scientists (Michael Faraday, Albert Einstein, Gregor Mendel, and Charles Darwin), the one who is known for developing the laws of heredity is C) Gregor Mendel. 
4 0
3 years ago
Other questions:
  • When white blood cells are called to an area of infection, not only is there phagocytosis taking place, but also exocytosis of u
    13·1 answer
  • Which of the following statements is true regarding both theories and laws? Change over time
    7·2 answers
  • Put in order from first to last
    7·1 answer
  • Which protist exhibits both animal-like and plant-like characteristics? a protist that has pseudopods and swims by using cilia a
    8·2 answers
  • Capillary action:
    13·1 answer
  • A physical system is best characterized as a collection of:
    7·1 answer
  • What percentage of the filtrates water that enters bowmans capsule is reabsorbed into the blood?
    15·2 answers
  • Sexual reproduction involves a process called meiosis. What type of cells are produced during this process?
    9·2 answers
  • 3. A strain of cells undergoes a mutation that increases the permeability of the inner
    7·1 answer
  • What molecule enters the citric acid cycle and combines with oxaloacetate to form citric acid?.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!