1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina86 [1]
3 years ago
13

What is the term for deep cold waters that replace warm surface waters?

Biology
1 answer:
Verdich [7]3 years ago
6 0

Answer: This process is known as upwelling

Explanation:

You might be interested in
What is the hydrolysis of atp and preparation for reattachment to the thin filament by the myosin head called?
QveST [7]

The hydrolysis of atp and preparation for reattachment to the thin filament by the myosin head called the recovery stroke.

<h3>What is myosin ? </h3>

Myosins are a class of motor proteins well recognized for their functions in the contraction of muscles and a variety of other eukaryotic motility processes. They are ATP-dependent and in charge of motility based on actin. By Wilhelm Kühne, the first myosin was identified in 1864.

<h3>When the myosin pulls the actin what is happening?</h3>

The actin is drawn along by the myosin head as it advances in the direction of the M line. The filaments migrate nearer the M line by around 10 nm as the actin is tugged. The power stroke is the name given to this motion because it is where force is generated.

To know more about atp visit :

brainly.com/question/174043

#SPJ4

5 0
2 years ago
Summarize the process of fertilization and implantation.
Aneli [31]
The process of fertilization involves the deposition of sperms into the vagina to the egg cell during sexual intercourse. Sperms make their way towards the cervix and uterus, and eventually goes to the fallopian tubes. <span>Only a few hundred will remain as they interact with the egg through the use of their heads and movement patterns.

</span><span>The process of implantation happens when the embryo, the fertimized eggs develops inside the fallopian tube after three days, and then travels to the uterus.</span>
7 0
4 years ago
What two words best describe bacterial reproduction? Why?
Vadim26 [7]

Answer: Bacteria reproduce through a process called binary fission. During binary fission, the chromosome copies itself, forming two genetically identical copies. Then, the cell enlarges and divides into two new daughter cells. The two daughter cells are identical to the parent cell.

Explanation:

4 0
3 years ago
Organelles are
weeeeeb [17]
<span>B. tiny structures in the cell that carry out the cell's activities</span>
7 0
3 years ago
What best explains why angiosperms are the most diverse and successful plant group today
Pachacha [2.7K]
Because they have flowers which attract pollinators
6 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Explain how sustainability is dependent on the ecological footprint
    14·1 answer
  • (b) The grassland is ploughed up and turned into farmland. Crops of maize are grown on it
    7·2 answers
  • The sodium-potassium pump establishes concentration gradients:
    5·1 answer
  • Que es recombinacion genetica artificial?
    10·1 answer
  • What is the answer to number one
    10·2 answers
  • What are the two means of moving large molecules across the cell membrane with energy
    8·1 answer
  • Why are atoms of lithium, sodium, and potassium almost never found alone in nature
    9·2 answers
  • Persistence length for a cytoskeletal filament is the minimum filament length at which random thermal fluctuations are likely to
    11·1 answer
  • Most carbon dioxide is carried from the body tissues to the lungs _____.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!